G84324


Basic Information

Item Value
gene id G84324
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 10354683 ~ 10356731 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU95933
CGGGCGACACGAGACAGCACGCTCTTGTCTGCAGTGCTCCCATCACGGGATGCCTCACGGAAAAAGAAGTAAATCTTGTCATCATCAGGGTTGTAGGTGTCTGCGATGGGATGAGCAGAAATAAACTTGCCCTCGTTGATCCAGTAGTCCTCAGAGATGTCTGTGCGAATGTACTGCTGGTCTGGGGGCGGGCCAAGAGAGCGGCTAAACGTGGTGTCCTTGCCCAGGAAATCAGACGCGGTGCCAGCATAGAGATACTGAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU95933 True 262 lncRNA 0.54 2 10354683 10356731

Neighbor

gene id symbol gene type direction distance location
CI01000013_10335904_10336688 NA coding upstream 17787 10335904 ~ 10336896 (+)
CI01000013_10261599_10283287 NA coding upstream 70716 10260271 ~ 10283967 (+)
CI01000013_09681047_09683275 LRRC4, LRRC4.2 coding upstream 671250 9681047 ~ 9683433 (+)
CI01000013_09430170_09443518 RBM28 coding upstream 910660 9430170 ~ 9444023 (+)
CI01000013_09279917_09290301 TSPAN33B coding upstream 1063923 9279917 ~ 9290760 (+)
CI01000013_10502138_10525511 GRM3 coding downstream 143959 10500690 ~ 10525674 (+)
CI01000013_10586449_10594082 NA coding downstream 229087 10585818 ~ 10594442 (+)
CI01000013_10756927_10790192 FRMD4A coding downstream 400196 10756927 ~ 10792761 (+)
CI01000013_10808688_10819703 NA coding downstream 451957 10808688 ~ 10819925 (+)
CI01000013_10821530_10827412 SEPHS1, SEPHS1.L coding downstream 464799 10821530 ~ 10827977 (+)
G84323 NA non-coding upstream 4428 10348860 ~ 10350255 (+)
G84304 NA non-coding upstream 15681 10337498 ~ 10339002 (+)
G84299 NA non-coding upstream 67373 10286011 ~ 10287310 (+)
G84289 NA non-coding upstream 100424 10253174 ~ 10254259 (+)
G84265 NA non-coding upstream 167026 10186533 ~ 10187657 (+)
G84325 NA non-coding downstream 1027 10357758 ~ 10380783 (+)
G84364 NA non-coding downstream 106089 10462820 ~ 10463073 (+)
G84369 NA non-coding downstream 123724 10480455 ~ 10480859 (+)
G84353 NA non-coding downstream 185756 10542487 ~ 10545067 (+)
G84373 NA non-coding downstream 188659 10545390 ~ 10545646 (+)
G84250 NA other upstream 138721 10215127 ~ 10215962 (+)
G84215 NA other upstream 275347 10076454 ~ 10079336 (+)
G84194 NA other upstream 317890 10030608 ~ 10036953 (+)
G84005 NA other upstream 752448 9601611 ~ 9602235 (+)
G82581 NA other upstream 1019735 9329329 ~ 9334948 (+)
G84768 NA other downstream 1813258 12169989 ~ 12170818 (+)
G84790 NA other downstream 1828211 12184942 ~ 12201975 (+)
G84864 NA other downstream 2008318 12365049 ~ 12375905 (+)

Expression


Co-expression Network