G308066


Basic Information

Item Value
gene id G308066
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NW_019172850.1
NCBI id APWO02000117.1
chromosome length 3115925
location 21629 ~ 22198 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU424135
gttagattttagggttgattaagggttaaggttagggttaggtggagggtaagattttagggttgattaagggttaaggttagggttaggtgtagggttagattttagggttgattaagggttaaggttagggttaggtgtagggtttgattttagggttgatttagggttaaggttagggttaggtgtagggtttgattttagggttgattaagggttaaggttagggttaggtgtagggtta

Function

GO:

id name namespace
GO:0050878 regulation of body fluid levels biological_process
GO:0019538 protein metabolic process biological_process
GO:0030162 regulation of proteolysis biological_process
GO:0001775 cell activation biological_process
GO:0030168 platelet activation biological_process
GO:0007596 blood coagulation biological_process
GO:0007599 hemostasis biological_process
GO:0006508 proteolysis biological_process
GO:0050817 coagulation biological_process

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05020 Prion disease

RNA

RNA id representative length rna type GC content exon number start site end site
TU424135 True 244 lncRNA 0.40 2 21629 22198

Neighbor

gene id symbol gene type direction distance location
fam168a fam168a,LOC107600264,LOC107594362,LOC108264593,LOC107705757 coding downstream 761277 783475 ~ 841687 (+)
p2ry6 p2ry6,LOC107705774,LOC107601092,LOC107660676,LOC107735228 coding downstream 836850 859048 ~ 887291 (+)
arhgef17 si:ch211-248g20.5,arhgef17,LOC107660677,LOC107658857 coding downstream 872662 894860 ~ 1072523 (+)
relt relt coding downstream 1062235 1084433 ~ 1155289 (+)
LOC103036410 fchsd2,LOC107705784,LOC107594367,LOC107600282 coding downstream 1157359 1179557 ~ 1333842 (+)
G308067 NA non-coding downstream 2250 24448 ~ 77425 (+)
G308071 NA non-coding downstream 54985 77183 ~ 80440 (+)
LOC111191340 NA non-coding downstream 116306 138504 ~ 140502 (+)
G308091 NA non-coding downstream 187380 209578 ~ 210009 (+)
G308092 NA non-coding downstream 195527 217725 ~ 217942 (+)
G308090 NA other downstream 163139 185337 ~ 186075 (+)
serp1 NA other downstream 1805706 1827904 ~ 1832674 (+)
G308506 abcc5,LOC106580650,LOC107670605,LOC107671530,LOC107672635 other downstream 1995266 2017464 ~ 2020131 (+)
G308535 depdc7,LOC107758055,LOC107576633 other downstream 2108881 2131079 ~ 2143963 (+)
G308643 kifc3 other downstream 2297693 2319891 ~ 2338166 (+)

Expression


Co-expression Network