G93954



Basic Information


Item Value
gene id G93954
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 509071 ~ 509303 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU106917
CTTTATCTATACCACTGCTGCACAAATCCTTTGTCTACGGTGCTATAATTCTATAGTATTCAGATTGCCAATAAGAACTTAGATGCTGATTATAATTTGTTCTTTTCATGATGGAAGACACAATCATAATTGCTTCTAACTCTGCTGAAGCTCAACAATAAAGTAAATCAGAGGACAAAGAAATGTGTTTCTGCTCATCCAAAAAATTTGGCGTTTACTCTTGAGCAATATTT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU106917 True 233 lncRNA 0.33 1 509071 509303

Neighbor


gene id symbol gene type direction distance location
CI01000016_00471859_00490955 NAGPA coding downstream 18116 470783 ~ 490955 (-)
CI01000016_00456765_00460615 TP53INP1 coding downstream 47862 454828 ~ 461209 (-)
CI01000016_00448107_00452861 CCNE2 coding downstream 56210 447858 ~ 452861 (-)
CI01000016_00251025_00251471 GBP coding downstream 257585 250218 ~ 251486 (-)
CI01000016_00166492_00172759 SERINC2L coding downstream 336312 166085 ~ 172759 (-)
CI01000016_00513504_00514565 NA coding upstream 2821 512124 ~ 514744 (-)
CI01000016_00581946_00586945 NA coding upstream 72563 581866 ~ 586997 (-)
CI01000016_00589778_00591095 METTL6 coding upstream 80369 589672 ~ 591294 (-)
CI01000016_00592794_00596916 NA coding upstream 82827 592130 ~ 597102 (-)
CI01000016_00601605_00607255 RSPO3 coding upstream 91319 600622 ~ 607255 (-)
G93934 NA non-coding downstream 107299 400493 ~ 401772 (-)
G93873 NA non-coding downstream 227860 280994 ~ 281211 (-)
G93835 NA non-coding downstream 306125 199158 ~ 202946 (-)
G93829 NA non-coding downstream 319733 188604 ~ 189338 (-)
G93801 NA non-coding downstream 358106 62817 ~ 150965 (-)
G93988 NA non-coding upstream 64997 574300 ~ 576181 (-)
G93992 NA non-coding upstream 69914 579217 ~ 579783 (-)
G94011 NA non-coding upstream 126864 636167 ~ 636370 (-)
G94017 NA non-coding upstream 135370 644673 ~ 644880 (-)
CI01000016_00679328_00729780 NA non-coding upstream 198747 678792 ~ 729966 (-)
G94786 NA other upstream 1761533 2270836 ~ 2276275 (-)
G95070 NA other upstream 2475957 2985260 ~ 2985641 (-)
CI01000016_03647744_03675574 NA other upstream 3126304 3647653 ~ 3675585 (-)
CI01000016_03921124_03930996 NA other upstream 3356458 3920055 ~ 3931162 (-)
CI01000016_04921091_04922518 NA other upstream 4403405 4918975 ~ 4922518 (-)

Expression



Co-expression Network