G93300


Basic Information

Item Value
gene id G93300
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 634102 ~ 634319 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU106167
CAATAATGGAATGACATTATTGTAATAGTTTAGCTAGCTAGCAAAGGTCAGCTGCAGTCTGTTAAGCTGTAACAATAACAACATTAATGCTAGTGATATAATGTTGATTAGTCGTATGTTAAGGACTGCCATGGCATTTGTATTATGGATTAAATCAACATCGGAGACCTGCCTGCCCACTGCCACCACAGCCAGTACTACTGGCCCAGACCTACCAC

Function

NR:

description
retinol-binding protein 1-like

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU106167 True 218 lncRNA 0.41 1 634102 634319

Neighbor

gene id symbol gene type direction distance location
CI01000016_00569502_00581271 NA coding upstream 52603 569502 ~ 581499 (+)
CI01000016_00540871_00541608 PLEKHF2.L, PLEKHF2 coding upstream 92379 540632 ~ 541723 (+)
CI01000016_00496095_00506965 NDUFAF6 coding upstream 127069 496095 ~ 507033 (+)
CI01000016_00318676_00446341 NA coding upstream 187761 318676 ~ 446341 (+)
CI01000016_00294886_00298452 NA coding upstream 334941 294886 ~ 299161 (+)
CI01000016_00772375_00772848 NA coding downstream 137951 772270 ~ 772889 (+)
CI01000016_00885996_00887374 NA coding downstream 251677 885996 ~ 887478 (+)
CI01000016_00952494_00954683 NA coding downstream 318175 952494 ~ 954953 (+)
CI01000016_00959079_00960728 NA coding downstream 324334 958653 ~ 961060 (+)
CI01000016_00972599_01002933 NA coding downstream 337793 972112 ~ 1003172 (+)
G93290 NA non-coding upstream 16140 617432 ~ 617962 (+)
G93161 NA non-coding upstream 170123 460440 ~ 463979 (+)
G93157 NA non-coding upstream 177095 450613 ~ 457007 (+)
G93224 NA non-coding upstream 265923 309289 ~ 368179 (+)
G93216 NA non-coding upstream 349252 284593 ~ 284850 (+)
G93301 NA non-coding downstream 5342 639661 ~ 639878 (+)
G93310 NA non-coding downstream 29685 664004 ~ 664235 (+)
G93313 NA non-coding downstream 32046 666365 ~ 666745 (+)
G93322 NA non-coding downstream 47795 682114 ~ 682582 (+)
G93323 NA non-coding downstream 50030 684349 ~ 684570 (+)
G93406 NA other downstream 271081 905400 ~ 927532 (+)
G95439 NA other downstream 3227856 3862175 ~ 3862305 (+)
G95648 NA other downstream 3638317 4272636 ~ 4273905 (+)
CI01000016_04829592_04837305 NA other downstream 4200239 4829592 ~ 4837457 (+)
G95792 NA other downstream 4585561 5219880 ~ 5225941 (+)

Expression


Co-expression Network