G95172



Basic Information


Item Value
gene id G95172
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 2877531 ~ 2877739 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU108284
GTCTCTGCTTCTAATAAACCAGGCAACTACTACTTCTACTTTGTGTATATTCAACGTAGTGACGATGCAAGCTGCCTCTAAAAACACGAACGATTTAGAAGAACAACAACATAGTGATGAAACGCACTCTGTAGAGTGTTTGTCCGCTTAGGGCTACTGTAGAAACATGCTGGCGCAAAATAATGACTTGACATGGAAGGGGGACCCGC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU108284 True 209 lncRNA 0.44 1 2877531 2877739

Neighbor


gene id symbol gene type direction distance location
CI01000016_02817855_02829699 NA coding downstream 47074 2817855 ~ 2830457 (-)
CI01000016_02802780_02815803 NA coding downstream 61728 2802599 ~ 2815803 (-)
CI01000016_02679833_02695963 SH3BP5B, SH3BP5 coding downstream 181568 2678538 ~ 2695963 (-)
CI01000016_02589744_02622875 NA coding downstream 254656 2589475 ~ 2622875 (-)
CI01000016_02568824_02575674 DECR1 coding downstream 301857 2568610 ~ 2575674 (-)
CI01000016_02884294_02912568 MAP7D1A coding upstream 5107 2882846 ~ 2912568 (-)
CI01000016_02936606_02957342 NA coding upstream 58370 2936109 ~ 2957875 (-)
CI01000016_02991852_02994428 CITED2, CITED4B coding upstream 113481 2991220 ~ 2994428 (-)
CI01000016_03060171_03060612 RAB42B coding upstream 181804 3059543 ~ 3060612 (-)
CI01000016_03062846_03063013 NA coding upstream 185107 3062846 ~ 3063272 (-)
G95166 NA non-coding downstream 12400 2864769 ~ 2865131 (-)
G95161 NA non-coding downstream 28628 2848679 ~ 2848903 (-)
G95158 NA non-coding downstream 37837 2839470 ~ 2839694 (-)
G95157 NA non-coding downstream 39011 2838255 ~ 2838520 (-)
G95154 NA non-coding downstream 101665 2775445 ~ 2775866 (-)
G95181 NA non-coding upstream 141055 3018794 ~ 3019070 (-)
G95199 NA non-coding upstream 165928 3043667 ~ 3043866 (-)
G95191 NA non-coding upstream 172152 3049891 ~ 3050726 (-)
G95203 NA non-coding upstream 213626 3091365 ~ 3091751 (-)
G95210 NA non-coding upstream 228021 3105760 ~ 3106448 (-)
G94786 NA other downstream 601256 2270836 ~ 2276275 (-)
G95070 NA other upstream 107521 2985260 ~ 2985641 (-)
CI01000016_03647744_03675574 NA other upstream 757868 3647653 ~ 3675585 (-)
CI01000016_03921124_03930996 NA other upstream 988022 3920055 ~ 3931162 (-)
CI01000016_04921091_04922518 NA other upstream 2034969 4918975 ~ 4922518 (-)
CI01000016_05325805_05330265 COX6B2 other upstream 2447780 5325519 ~ 5332874 (-)

Expression



Co-expression Network