G95621


Basic Information

Item Value
gene id G95621
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 3993037 ~ 3993261 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU108759
ACTAGAGTAAGCTCAGGAGAGGATTTGTGGACTAAAGCGGGCTCTAGAATGACCTCATGGACTGAAACAAGCTCAGCAAAACACTCGAGGACTGAAGCGGGCTCTGCAATTGCTTCCTGGACTGGAATAAACTCAGGAATGGACTCATGGACTGGAGCGGGCTCTGGAGCAGCTGTCTTGTTTAATGCAGCTTCGACAAGCATCGCCCAAACACACCAAAATGCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU108759 True 225 lncRNA 0.50 1 3993037 3993261

Neighbor

gene id symbol gene type direction distance location
CI01000016_03977127_03981586 NA coding upstream 10469 3977079 ~ 3982568 (+)
CI01000016_03965750_03967383 NA coding upstream 25640 3965498 ~ 3967397 (+)
CI01000016_03951956_03957698 NA coding upstream 35155 3951410 ~ 3957882 (+)
CI01000016_03942653_03949757 NA coding upstream 43117 3942483 ~ 3949920 (+)
CI01000016_03912450_03917198 NA coding upstream 75818 3911862 ~ 3917219 (+)
CI01000016_04008568_04016209 NA coding downstream 15259 4008520 ~ 4016502 (+)
CI01000016_04019056_04035116 NA coding downstream 25749 4019010 ~ 4035238 (+)
CI01000016_04038553_04043435 NA coding downstream 45243 4038504 ~ 4043574 (+)
CI01000016_04054332_04058529 NA coding downstream 60760 4054021 ~ 4058698 (+)
CI01000016_04062946_04083356 CSN7A, COPS7A coding downstream 69442 4062703 ~ 4083560 (+)
G95500 NA non-coding upstream 3926 3986772 ~ 3989111 (+)
CI01000016_03798165_03803686 NA non-coding upstream 187037 3798037 ~ 3804627 (+)
CI01000016_03767260_03771612 NA non-coding upstream 222810 3766998 ~ 3771828 (+)
G95533 NA non-coding upstream 265540 3669705 ~ 3727497 (+)
G95622 NA non-coding downstream 13 3993274 ~ 3993474 (+)
G95623 NA non-coding downstream 545 3993806 ~ 3994081 (+)
G95626 NA non-coding downstream 7520 4000781 ~ 4001100 (+)
G95445 NA non-coding downstream 84122 4077383 ~ 4181941 (+)
G95649 NA non-coding downstream 378320 4371581 ~ 4371833 (+)
G95439 NA other upstream 129180 3862175 ~ 3862305 (+)
G93406 NA other upstream 3065505 905400 ~ 927532 (+)
G95648 NA other downstream 279375 4272636 ~ 4273905 (+)
CI01000016_04829592_04837305 NA other downstream 841297 4829592 ~ 4837457 (+)
G95792 NA other downstream 1226619 5219880 ~ 5225941 (+)
CI01000016_05405791_05407797 AICDA other downstream 1412608 5405791 ~ 5407963 (+)
G96389 NA other downstream 3167380 7160641 ~ 7161290 (+)

Expression


Co-expression Network