G98709


Basic Information

Item Value
gene id G98709
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 8816414 ~ 8816889 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU112329
CAGTCTAGTTCTGTAGGCTACACAATCATGGGGAAGACTGCTGACTTGACAGTTGTCAAAAAGACGACCATTGACACCTTGCACAAGGAGGGCAAGACACAAAAGGTCATTGCAAAAGAGGCTGGCTGTTCACAGAGCTCTGTGTCCAAGCACATTAATAGCGAGGAGAAAATCTATGGGGTATTGTGAAGAGGAAGATGCGATATGCCAGACCCAACAATGCAGAAGAGCTGAAGGCCACTATCAGAGCAACCTGGGCTCTTATAACACCTGAGCAGTGCCACAGACTGATCGACTCCATGCCACGCCACATTGCTGCAGTATTTCAGGCAAAAGGAACCCCAACTAAGTATTGAGTGCTGTACATGCTCATACTTTTCATGTTCATACTTTTCAGTTGGCCAAGATTTCTAAAAATCTTTTCTTTGTATTGGTCTTAAGTAATATTCTAATTTTCTGAGATACTGAATTTGGGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU112329 True 476 lncRNA 0.43 1 8816414 8816889

Neighbor

gene id symbol gene type direction distance location
CI01000016_08800360_08805384 NA coding downstream 11030 8798407 ~ 8805384 (-)
CI01000016_08769141_08795202 NA coding downstream 20855 8768822 ~ 8795559 (-)
CI01000016_08741387_08746007 NA coding downstream 70348 8740982 ~ 8746066 (-)
CI01000016_08642218_08643021 NA coding downstream 173393 8641441 ~ 8643021 (-)
CI01000016_08605369_08623062 STK31 coding downstream 193352 8605247 ~ 8623062 (-)
CI01000016_08833925_08836497 NA coding upstream 16601 8833490 ~ 8836497 (-)
CI01000016_08851218_08869647 IFFO1B coding upstream 33983 8850872 ~ 8869647 (-)
CI01000016_08871984_08874796 OPN9 coding upstream 55095 8871984 ~ 8874796 (-)
CI01000016_08881761_08888177 GAPDH coding upstream 64662 8881551 ~ 8888237 (-)
CI01000016_08893013_08893496 NPPCL, ANFC1 coding upstream 75709 8888833 ~ 8894737 (-)
G98708 NA non-coding downstream 713 8814845 ~ 8815701 (-)
G98714 NA non-coding downstream 5182 8810429 ~ 8811232 (-)
G98713 NA non-coding downstream 7422 8808550 ~ 8808992 (-)
G98711 NA non-coding downstream 37820 8778362 ~ 8778594 (-)
G98710 NA non-coding downstream 50956 8765130 ~ 8765458 (-)
G98715 NA non-coding upstream 54386 8871275 ~ 8871516 (-)
G98672 NA non-coding upstream 99033 8915922 ~ 8916673 (-)
G98658 NA non-coding upstream 107621 8924510 ~ 8925768 (-)
G98694 NA non-coding upstream 240923 9057812 ~ 9058118 (-)
G98776 NA non-coding upstream 284712 9101601 ~ 9101813 (-)
G97341 NA other downstream 2656693 6158986 ~ 6159721 (-)
CI01000016_05412782_05415867 NA other downstream 3398197 5412248 ~ 5415906 (-)
CI01000016_05325805_05330265 COX6B2 other downstream 3485568 5325519 ~ 5332874 (-)
CI01000016_04921091_04922518 NA other downstream 3893010 4918975 ~ 4922518 (-)
CI01000016_03921124_03930996 NA other downstream 4885363 3920055 ~ 3931162 (-)
CI01000016_08926089_08945071 NA other upstream 119900 8925960 ~ 8945229 (-)
G98679 NA other upstream 418107 9234996 ~ 9239929 (-)
G98691 NA other upstream 439213 9256102 ~ 9257611 (-)
CI01000016_09510177_09512196 ID4 other upstream 692733 9509622 ~ 9512428 (-)

Expression


Co-expression Network