G98853


Basic Information

Item Value
gene id G98853
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000016
NCBI id null
chromosome length 12175457
location 9356362 ~ 9397519 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU112490
AAAATTATATACTTTAACCATAAATGCTCGTCTTGCACTGCTCTGCGATGTGCAACGCATTATGTAATCATGTTGGAAAGGTCAAGCGTGACGTAGGCGGAAGTACCGATTCAGTGTCTACTAAGTCAAACGGCCTTTACAAAAAAAAAGGTCAAACATCGTTGTCGGACGATTTTGAAGTTGGAGGAGAAAATGAGATGAAATGAGAGTTTTTCACCCTACCGCGGTACTTCTGTCTCACACGTGACCTTTCCAATGTGGCTACGGGGTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU112490 True 271 lncRNA 0.43 2 9356362 9397519

Neighbor

gene id symbol gene type direction distance location
CI01000016_09251602_09253351 NA coding downstream 103011 9251412 ~ 9253351 (-)
CI01000016_09224593_09226660 NA coding downstream 129702 9224467 ~ 9226660 (-)
CI01000016_09212039_09212358 NA coding downstream 143192 9211997 ~ 9213170 (-)
CI01000016_09185530_09205841 NA coding downstream 150328 9185404 ~ 9206034 (-)
CI01000016_09164404_09171973 CCDC106A, CCDC106 coding downstream 181604 9164404 ~ 9174758 (-)
CI01000016_09410080_09416286 NCALDA, NCALDB, HPCAL1, NCALD.L, NCALD coding upstream 12387 9409906 ~ 9417767 (-)
CI01000016_09475913_09487996 NA coding upstream 77478 9474997 ~ 9488292 (-)
CI01000016_09510177_09512196 ID4 coding upstream 112140 9509622 ~ 9512428 (-)
CI01000016_09638800_09651752 CEP76 coding upstream 241073 9638592 ~ 9651752 (-)
CI01000016_09654611_09661197 NA coding upstream 255983 9653502 ~ 9661197 (-)
G98808 NA non-coding downstream 10914 9344604 ~ 9345448 (-)
G98838 NA non-coding downstream 30122 9325886 ~ 9326240 (-)
G98809 NA non-coding downstream 30664 9325167 ~ 9325698 (-)
G98802 NA non-coding downstream 31867 9317571 ~ 9324495 (-)
G98834 NA non-coding downstream 42357 9313575 ~ 9314005 (-)
G98878 NA non-coding upstream 82875 9480394 ~ 9480627 (-)
G98885 NA non-coding upstream 92046 9489565 ~ 9489806 (-)
G98887 NA non-coding upstream 96124 9493643 ~ 9493939 (-)
G98898 NA non-coding upstream 116246 9513765 ~ 9513998 (-)
G98691 NA other downstream 98751 9256102 ~ 9257611 (-)
G98679 NA other downstream 116433 9234996 ~ 9239929 (-)
CI01000016_08926089_08945071 NA other downstream 411133 8925960 ~ 8945229 (-)
CI01000016_08893013_08893496 NPPCL, ANFC1 other downstream 461625 8888833 ~ 8894737 (-)
G97341 NA other downstream 3196641 6158986 ~ 6159721 (-)
G99178 NA other upstream 416842 9814361 ~ 9814955 (-)
G100190 NA other upstream 653649 10051168 ~ 10052389 (-)

Expression


Co-expression Network