G105336


Basic Information

Item Value
gene id G105336
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000018
NCBI id null
chromosome length 7078422
location 4741661 ~ 4741921 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU119725
CTTCCTTTGCATTCAGCAGAACAAAGAAATTCATACAGGTTTGGAACTACATGGGGGTGAGTAAATGATGAGTAAAAGCATATTAGAATGATTTCTGAAGAATCATGTGACACTGAAGAATGGAGTAACAGAGCTTTGCCATCACAGGAATAAATTACATTTTAAAATATATTAAAATAGAAAACAATTATTTTAAATTGTAATCATTTTTCACAATATTACTGTTTTTACTGTATTTTTCTTCAAATAAATGCAGCCCTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU119725 True 261 lncRNA 0.29 1 4741661 4741921

Neighbor

gene id symbol gene type direction distance location
CI01000018_04657706_04674073 NA coding downstream 67588 4657571 ~ 4674073 (-)
CI01000018_04627321_04645724 LNX2A, LNX2 coding downstream 95479 4627169 ~ 4646182 (-)
CI01000018_04604468_04611851 USP12.S, USP46, USP12, USP12.L, RGD1561481, USP12A, USP12-LIKE coding downstream 129810 4603787 ~ 4611851 (-)
CI01000018_04595424_04596449 GPR12 coding downstream 144074 4594465 ~ 4597587 (-)
CI01000018_04557779_04561445 RNF6 coding downstream 179664 4557636 ~ 4561997 (-)
CI01000018_04759598_04770734 TMPRSS7 coding upstream 17588 4759509 ~ 4770734 (-)
CI01000018_04773554_04792048 SPATA13 coding upstream 31305 4773226 ~ 4792048 (-)
CI01000018_04798056_04800698 C1QTNF9 coding upstream 56057 4797978 ~ 4800698 (-)
CI01000018_04803745_04804788 TAGLN3B, TAGLN3 coding upstream 61196 4803117 ~ 4804796 (-)
CI01000018_04807843_04810778 ABHD10B, ABHD10 coding upstream 65645 4807566 ~ 4810778 (-)
G105209 NA non-coding downstream 90314 4649881 ~ 4651347 (-)
G105328 NA non-coding downstream 120033 4621351 ~ 4621628 (-)
G105199 NA non-coding downstream 126281 4612697 ~ 4615380 (-)
G105213 NA non-coding downstream 153886 4584628 ~ 4587775 (-)
G105307 NA non-coding downstream 287183 4454261 ~ 4454478 (-)
G105350 NA non-coding upstream 25690 4767611 ~ 4768386 (-)
G105413 NA non-coding upstream 516391 5258312 ~ 5258511 (-)
G105219 NA non-coding upstream 540785 5282706 ~ 5284386 (-)
G105464 NA non-coding upstream 623129 5365050 ~ 5489735 (-)
G105526 NA non-coding upstream 751915 5493836 ~ 5494106 (-)
G105200 NA other downstream 495651 4243467 ~ 4246010 (-)
G105104 NA other downstream 723844 4007697 ~ 4017817 (-)
G104968 NA other downstream 1241147 3482104 ~ 3500514 (-)
CI01000018_02389202_02488018 CNTNAP2, CNTNAP2A other downstream 2340758 2389201 ~ 2488018 (-)
G103842 NA other downstream 2781603 1959497 ~ 1960058 (-)
CI01000018_04856240_04875704 DAP other upstream 113160 4855081 ~ 4876532 (-)
CI01000018_06021105_06025859 NA other upstream 1149415 6020861 ~ 6025876 (-)
G106538 NA other upstream 1788526 6530447 ~ 6533512 (-)
CI01000018_06639339_06649926 NA other upstream 1898691 6639207 ~ 6649971 (-)

Expression


Co-expression Network