G124980



Basic Information


Item Value
gene id G124980
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000024
NCBI id null
chromosome length 8644187
location 6715908 ~ 6716180 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU141870
TTTTACTCTAATAAAGCGTAAAAATACCCCAATATGTTTGCAGATATTTAGGAAACATGCTAAGTTCACCTACTTGTTTCTCAGAAAAACAATGCTACAGCCAGATATTCTACTTTGAAATGTGCGAATGTCTGTCTTTGTTTTGGTCTGTGCGAAACCGCGTGCTGCCAGTTTATCCAATAGTATTTCGACATCACATGTTGCCAGTTGTCGGAAAACACCGCGTATTGCAGCCATGGAAACCAGCAAACAAACTTGGTCAGAGAATCGCAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU141870 True 273 lncRNA 0.40 1 6715908 6716180

Neighbor


gene id symbol gene type direction distance location
CI01000024_06451305_06495178 NA coding downstream 217478 6451112 ~ 6498430 (-)
CI01000024_05986174_06002425 NA coding downstream 713099 5985732 ~ 6002809 (-)
CI01000024_05879244_05880952 NA coding downstream 834594 5878709 ~ 5881314 (-)
CI01000024_05749044_05807817 NA coding downstream 907827 5748897 ~ 5808081 (-)
CI01000024_05422777_05445492 TRAK2 coding downstream 1270416 5422777 ~ 5445492 (-)
CI01000024_06867041_06878399 NA coding upstream 150861 6867041 ~ 6878813 (-)
CI01000024_06889558_06901776 MTIF2 coding upstream 173267 6889447 ~ 6902501 (-)
CI01000024_06909681_06921880 CCDC88AA coding upstream 193142 6909322 ~ 6921880 (-)
CI01000024_06944906_06955771 NA coding upstream 227782 6943962 ~ 6955771 (-)
CI01000024_06987928_07001260 CEP170L coding upstream 271276 6987456 ~ 7001358 (-)
G124965 NA non-coding downstream 19135 6696543 ~ 6696773 (-)
G124961 NA non-coding downstream 22187 6693450 ~ 6693721 (-)
G124946 NA non-coding downstream 51762 6663799 ~ 6664146 (-)
G124945 NA non-coding downstream 54792 6660879 ~ 6661116 (-)
G124931 NA non-coding downstream 78401 6637273 ~ 6637507 (-)
G125011 NA non-coding upstream 36735 6752915 ~ 6753141 (-)
G125020 NA non-coding upstream 45075 6761255 ~ 6761888 (-)
G125309 NA non-coding upstream 48008 6764188 ~ 6764891 (-)
G125312 NA non-coding upstream 60272 6776452 ~ 6776668 (-)
G125344 NA non-coding upstream 136420 6852600 ~ 6852895 (-)
CI01000024_03938368_03941795 NA other downstream 2773984 3938315 ~ 3941924 (-)
G123233 NA other downstream 4160872 2547460 ~ 2555036 (-)
CI01000024_00825386_00837898 NA other downstream 5889057 824968 ~ 838550 (-)
G125457 NA other upstream 641057 7357237 ~ 7358104 (-)
G125798 NA other upstream 1259487 7975667 ~ 7976047 (-)

Expression



Co-expression Network