G133339


Basic Information

Item Value
gene id G133339
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 10381554 ~ 10381758 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU151601
CTAGGCACTCCTTATATACTTCCGGGTCGCGCTATGATGACGTCATAGGCTGTCGCTGGCCAATAGGATTGTCGTGAGTTGATATTGTTCTCAGACACCGGTTCACGTGGAGGCGTTCCCCATATGCGTTTCAAACGAAGTGTAGAGTTCCCTTTTGAAAGGGAAAGAGATTTAACTTTTTGCATCTTTTTTTATTACTTTTCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU151601 True 205 lncRNA 0.44 1 10381554 10381758

Neighbor

gene id symbol gene type direction distance location
CI01000026_10351923_10354175 CEBPG coding upstream 24859 10351403 ~ 10356695 (+)
CI01000026_10315650_10317985 NA coding upstream 63564 10315079 ~ 10317990 (+)
CI01000026_10265012_10268157 NA coding upstream 113006 10264945 ~ 10268548 (+)
CI01000026_10200749_10202405 NA coding upstream 179040 10198593 ~ 10202514 (+)
CI01000026_10136110_10149386 BRD7 coding upstream 232088 10135996 ~ 10149466 (+)
CI01000026_10453245_10454111 NA coding downstream 71367 10453125 ~ 10454176 (+)
CI01000026_10455059_10456945 CNEP1R1, CNEP1R1.L, TM188 coding downstream 73301 10455059 ~ 10457563 (+)
CI01000026_10458602_10465979 GPATCH1 coding downstream 76844 10458602 ~ 10466513 (+)
CI01000026_10468478_10482863 LRP3 coding downstream 86720 10468478 ~ 10482955 (+)
CI01000026_10521984_10543018 RHPN2 coding downstream 140226 10521984 ~ 10543108 (+)
G133338 NA non-coding upstream 5 10381254 ~ 10381549 (+)
G133336 NA non-coding upstream 7599 10373398 ~ 10373955 (+)
G133330 NA non-coding upstream 37488 10343711 ~ 10344066 (+)
G133329 NA non-coding upstream 37878 10343306 ~ 10343676 (+)
G133344 NA non-coding downstream 5284 10387042 ~ 10387244 (+)
G133373 NA non-coding downstream 133662 10515420 ~ 10515648 (+)
G133383 NA non-coding downstream 171202 10552960 ~ 10628076 (+)
G133406 NA non-coding downstream 403034 10784792 ~ 10785562 (+)
G133420 NA non-coding downstream 504295 10886053 ~ 10895159 (+)
G133192 NA other upstream 219593 10159819 ~ 10161961 (+)
G132667 NA other upstream 812394 9568739 ~ 9569160 (+)
G131077 NA other upstream 1874767 8501408 ~ 8506787 (+)
CI01000026_08297901_08307596 CTRB1 other upstream 2082140 8297857 ~ 8307629 (+)
G130967 NA other upstream 2192481 8188374 ~ 8189073 (+)
CI01000026_11075931_11078249 MDK, MDKA other downstream 689010 11075784 ~ 11079080 (+)
CI01000026_11241496_11246081 NA other downstream 863175 11241496 ~ 11246204 (+)
G133542 NA other downstream 1094359 11476117 ~ 11477544 (+)

Expression


Co-expression Network