G134345


Basic Information

Item Value
gene id G134345
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 12503262 ~ 12604181 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU152767
AAGAACTGTTTCTTGAGCAGCAAATCAGCAAATTAGAATGATTTCTGAAGGATCATGTGACACTGAAGACTGGAGTAATGATGCTGAAAATTCAGCTTTGCCATCACAGAATTTCTTTTCTGAAGACATTTTTGATAAAATATATGTAGCCTTGGTGACTACAAAAAAATCTTACCGACCCCAAAAGTTTGAATGGTAGAGTACATTTAATTCGTTATGAAACAGTAAATGCAAAACCTATTCAACTGTAAAACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU152767 True 255 lncRNA 0.34 2 12503262 12604181

Neighbor

gene id symbol gene type direction distance location
CI01000026_12425699_12438163 NA coding upstream 64641 12424079 ~ 12438621 (+)
CI01000026_12203244_12209526 SHH, SHHA coding upstream 293564 12201358 ~ 12209698 (+)
CI01000026_12192269_12200366 NA coding upstream 302528 12191652 ~ 12200734 (+)
CI01000026_12094316_12125431 NA coding upstream 376998 12094316 ~ 12126264 (+)
CI01000026_12074163_12076475 MNX1 coding upstream 425722 12073813 ~ 12077540 (+)
CI01000026_12653232_12657339 CHPF2 coding downstream 48891 12653072 ~ 12657836 (+)
CI01000026_12706512_12707086 NA coding downstream 101112 12705293 ~ 12707152 (+)
CI01000026_12867260_12871481 NA coding downstream 263030 12867211 ~ 12871720 (+)
CI01000026_12929788_12932668 HRH3 coding downstream 325458 12929639 ~ 12933391 (+)
CI01000026_12966022_12977066 ORC6 coding downstream 361415 12965596 ~ 12977588 (+)
G134314 NA non-coding upstream 21792 12456629 ~ 12481470 (+)
G134329 NA non-coding upstream 46800 12451916 ~ 12456462 (+)
G134282 NA non-coding upstream 93526 12409380 ~ 12409736 (+)
G134271 NA non-coding upstream 106972 12395063 ~ 12396290 (+)
G134262 NA non-coding upstream 124569 12378426 ~ 12378693 (+)
G134348 NA non-coding downstream 419 12604600 ~ 12605365 (+)
G134350 NA non-coding downstream 5085 12609266 ~ 12609676 (+)
G134356 NA non-coding downstream 12774 12616955 ~ 12617540 (+)
G134357 NA non-coding downstream 15260 12619441 ~ 12621548 (+)
G134359 NA non-coding downstream 17738 12621919 ~ 12622715 (+)
G133542 NA other upstream 1026355 11476117 ~ 11477544 (+)
CI01000026_11241496_11246081 NA other upstream 1248189 11241496 ~ 11246204 (+)
CI01000026_11075931_11078249 MDK, MDKA other upstream 1424182 11075784 ~ 11079080 (+)
G133192 NA other upstream 2341301 10159819 ~ 10161961 (+)
G132667 NA other upstream 2934102 9568739 ~ 9569160 (+)

Expression


Co-expression Network