CI01000029_05461497_05468985 (BATF)


Basic Information

Item Value
gene id CI01000029_05461497_05468985
gene name BATF
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 5461497 ~ 5470346 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000029_05461497_05468985.mRNA
GGTTCAACGGATGACGTAAGGAAAGTGATGAGGAGAGAAAAGAACCGAATCGCGGCGCAGAAGAGCCGAATGAGACAAACGCAGAAAGCCGACAGTCTGCACCTGGAGAGTGAAAATTTGGAGAAGGAAAACGCAGCGCTCAGGAAAGAGGTGAAGAGACTCACAGAAGAGGCCAAATATCTGTCCACGGTCCTGAGCAACCATGAGCCGCTGTGCACGGGCCTGAGCGGCGCGTCCACGGAGCTGCTGTACGGCGCGCATCACGGCGCGTTCCACCAGCACATCAGCGTGCCGCACTACCCGCTTTGACCGGCAGAGGCCGCCGGAGTTCCTCATGGAATCCGCCTGTGGGCGACAGTCAATGAACTTTGGTTGAGTCATAAACAACGTACATAGTCATCAGCGGGCATTGAAATGATCTTAAAATCATCTACTGAGTATCAGATAA

Function

symbol description
batf Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in several processes, including defense response to protozoan; immune system development; and regulation of gene expression. Predicted to act upstream of or within cell differentiation and regulation of transcription, DNA-templated. Predicted to be located in cytoplasm. Predicted to be active in nucleus. Orthologous to human BATF (basic leucine zipper ATF-like transcription factor).

GO:

id name namespace
GO:0005737 cytoplasm cellular_component

KEGG:

id description
K09034 BATF; ATF-like basic leucine zipper transcriptional factor

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000029_05461497_05468985.mRNA False 448 mRNA 0.54 2 5461497 5469124

Neighbor

gene id symbol gene type direction distance location
CI01000029_05444811_05447063 NA coding upstream 13833 5443358 ~ 5447664 (+)
CI01000029_05433797_05436469 NA coding upstream 25003 5433645 ~ 5436494 (+)
CI01000029_05402102_05409884 ZC3H14 coding upstream 51500 5402102 ~ 5409997 (+)
CI01000029_05390624_05394576 RAD51.S, RAD51.L, RAD51 coding upstream 66601 5390624 ~ 5394896 (+)
CI01000029_05380959_05388911 NA coding upstream 72317 5380959 ~ 5389180 (+)
CI01000029_05474130_05494930 ADCY3 coding downstream 4639 5473763 ~ 5495219 (+)
CI01000029_05496375_05508658 WDR26, WDR26B, WDR26.S coding downstream 27251 5496375 ~ 5508746 (+)
CI01000029_05512755_05521332 FEZ2 coding downstream 43631 5512755 ~ 5521332 (+)
CI01000029_05521742_05525648 FEZ2 coding downstream 52618 5521742 ~ 5525932 (+)
CI01000029_05577218_05577697 NA coding downstream 108094 5577218 ~ 5578537 (+)
G154564 NA non-coding upstream 7362 5453310 ~ 5454135 (+)
G154536 NA non-coding upstream 10206 5448056 ~ 5451291 (+)
G154620 NA non-coding upstream 33625 5427662 ~ 5427872 (+)
G154511 NA non-coding upstream 37277 5420112 ~ 5424220 (+)
G154560 NA non-coding upstream 102894 5358155 ~ 5358603 (+)
G154572 NA non-coding downstream 101978 5571102 ~ 5571475 (+)
G154674 NA non-coding downstream 241985 5711109 ~ 5711373 (+)
G154675 NA non-coding downstream 251164 5720288 ~ 5721868 (+)
CI01000029_05772821_05785145 NA non-coding downstream 316238 5772821 ~ 5785381 (+)
G154900 NA non-coding downstream 388585 5857709 ~ 5858056 (+)
G154587 NA other upstream 189962 5271020 ~ 5271535 (+)
G153790 NA other upstream 721390 4733589 ~ 4740107 (+)
G153475 NA other upstream 1899493 3545125 ~ 3562004 (+)
G152451 NA other upstream 2698558 2761594 ~ 2762939 (+)
CI01000029_01526863_01527414 NA other upstream 3933598 1526754 ~ 1527899 (+)
G155079 NA other downstream 813561 6282685 ~ 6288398 (+)
G155083 NA other downstream 962411 6431535 ~ 6490294 (+)
CI01000029_06906861_06907157 NA other downstream 1437064 6905834 ~ 6908633 (+)
G155522 NA other downstream 2165709 7634833 ~ 7637834 (+)
G155627 NA other downstream 2462356 7931480 ~ 7932177 (+)

Expression


Co-expression Network