G155142


Basic Information

Item Value
gene id G155142
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 6431948 ~ 6432805 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU176166
TTATGAGCAGATAACGTGGAGAAAAATCTGACAGGAAGTCGACTTTTGCCCACCTTATGGCTATAATGGGGTGGATGGAGAAGGTAGTAAAGGCAGGACTTGTGCGCCAAGCGCAGCACCTCTTTGAAGATATATTTGGCGTGATGCTGGAAAACAGGGTTGAGGAGAAAGTGACACAGTCGACCGTGCTCCTCTCGCTGGTGGTGGCTGAAGTACATGAACCTCTCGACGTCAAAGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU176166 True 238 lncRNA 0.49 2 6431948 6432805

Neighbor

gene id symbol gene type direction distance location
CI01000029_06347167_06348123 NA coding upstream 83779 6346660 ~ 6348169 (+)
CI01000029_06305668_06307332 NKX2.4B coding upstream 124273 6305245 ~ 6307675 (+)
CI01000029_06294088_06295613 NA coding upstream 135922 6293019 ~ 6296026 (+)
CI01000029_06214396_06222690 NA coding upstream 209213 6212878 ~ 6222735 (+)
CI01000029_06086495_06092753 NA coding upstream 338089 6086495 ~ 6093859 (+)
CI01000029_06443365_06447942 CRNKL1 coding downstream 10560 6443365 ~ 6447942 (+)
CI01000029_06453008_06476863 NA coding downstream 20203 6453008 ~ 6477090 (+)
CI01000029_06494856_06495812 NA coding downstream 61586 6494391 ~ 6495847 (+)
CI01000029_06724205_06734079 HMBOX1B, HMBOX1 coding downstream 291400 6724205 ~ 6735582 (+)
CI01000029_06775631_06791278 INTS9 coding downstream 342826 6775631 ~ 6791346 (+)
G155128 NA non-coding upstream 39955 6391776 ~ 6391993 (+)
G155124 NA non-coding upstream 46908 6384764 ~ 6385040 (+)
G155121 NA non-coding upstream 50162 6381467 ~ 6381786 (+)
G155110 NA non-coding upstream 89177 6342548 ~ 6342771 (+)
G155087 NA non-coding upstream 96997 6323091 ~ 6334951 (+)
G155162 NA non-coding downstream 81922 6514727 ~ 6514978 (+)
G155186 NA non-coding downstream 145470 6578275 ~ 6578494 (+)
G155196 NA non-coding downstream 169511 6602316 ~ 6602531 (+)
G155193 NA non-coding downstream 170290 6603095 ~ 6607105 (+)
G155194 NA non-coding downstream 240132 6672937 ~ 6680968 (+)
G155079 NA other upstream 143550 6282685 ~ 6288398 (+)
CI01000029_05461497_05468985 BATF other upstream 961602 5461497 ~ 5470346 (+)
G154587 NA other upstream 1160413 5271020 ~ 5271535 (+)
G153790 NA other upstream 1691841 4733589 ~ 4740107 (+)
G153475 NA other upstream 2869944 3545125 ~ 3562004 (+)
CI01000029_06906861_06907157 NA other downstream 473383 6905834 ~ 6908633 (+)
G155522 NA other downstream 1202028 7634833 ~ 7637834 (+)
G155627 NA other downstream 1498675 7931480 ~ 7932177 (+)
G156007 NA other downstream 2532013 8964818 ~ 9064541 (+)

Expression


Co-expression Network