G155615


Basic Information

Item Value
gene id G155615
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 7831634 ~ 7832091 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU176695
CGCGTCCTCACCGTAATGTTCACTGATAAAATCCTGAAGAGGTACAGTCATGTCAATCTCTTTAGTCTCTTTCAACCCCAGTGGAATCATGGGAACATTGACTGTCTCACTCTCGGTCTGGTAGACGTTCATACTGCTGTTCAGTTCCTCTAGTTCTTCTTTCAGAAGCTGAAGGTTTGAGTTCACAAAACTCAGTTCTAACGCTACAGTCTCCTTCACCTTCTGATTACTGCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU176695 True 234 lncRNA 0.44 3 7831634 7832091

Neighbor

gene id symbol gene type direction distance location
CI01000029_07672445_07687240 DUSP10 coding upstream 143761 7672445 ~ 7687873 (+)
CI01000029_07653640_07663101 NA coding upstream 168533 7653334 ~ 7663101 (+)
CI01000029_07643406_07651059 NA coding upstream 180253 7643406 ~ 7651381 (+)
CI01000029_07602986_07608307 AIDA, AIDA.L coding upstream 223308 7602669 ~ 7608326 (+)
CI01000029_07540982_07543852 NA coding upstream 287739 7538942 ~ 7543895 (+)
CI01000029_07885342_07908699 ARHGAP39 coding downstream 52191 7884282 ~ 7909792 (+)
CI01000029_07922221_07926151 NA coding downstream 90130 7922221 ~ 7927536 (+)
CI01000029_07933165_07944093 NA coding downstream 101074 7933165 ~ 7944093 (+)
CI01000029_07997857_08002279 PYCRL coding downstream 165605 7997696 ~ 8003097 (+)
CI01000029_08007965_08016092 EEF1DB, EEF1D coding downstream 174964 8007055 ~ 8016149 (+)
G155613 NA non-coding upstream 13284 7818140 ~ 7818350 (+)
G155611 NA non-coding upstream 14570 7816838 ~ 7817064 (+)
G155563 NA non-coding upstream 112416 7718903 ~ 7719218 (+)
G155561 NA non-coding upstream 114476 7716464 ~ 7717158 (+)
G155555 NA non-coding upstream 127252 7704138 ~ 7704382 (+)
G155619 NA non-coding downstream 2891 7834982 ~ 7835192 (+)
G155620 NA non-coding downstream 3153 7835244 ~ 7835464 (+)
G155644 NA non-coding downstream 104538 7936629 ~ 7936921 (+)
G155645 NA non-coding downstream 107456 7939547 ~ 7940799 (+)
G155522 NA other upstream 193800 7634833 ~ 7637834 (+)
CI01000029_06906861_06907157 NA other upstream 924202 6905834 ~ 6908633 (+)
G155083 NA other upstream 1341340 6431535 ~ 6490294 (+)
G155079 NA other upstream 1543236 6282685 ~ 6288398 (+)
CI01000029_05461497_05468985 BATF other upstream 2361288 5461497 ~ 5470346 (+)
G155627 NA other downstream 99389 7931480 ~ 7932177 (+)
G156007 NA other downstream 1132727 8964818 ~ 9064541 (+)

Expression


Co-expression Network