G155722


Basic Information

Item Value
gene id G155722
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 8240376 ~ 8240659 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU176810
GGTTCGGGCGGTCAGTGTCAGAGATGAAGGCAGTGCGTCACACCTGTGGAATGGCACAGAAGTTGAAGACGCTCTGGTTGCGGAGGCGGGACAGGTATGCGATGACATCAGGGACGTGGCGGAGGGCGTCGGTCACCAGCAGGTTGAGACAGGACAGGGCGGAGCTCAGGTGCTGAGGCTGGGCCAAATCCTCCAGACGGGACGCGAACTGACTCCAGGCCTGCAGAAACAACCAGCAATAATGAGCCTCTGTTTAACCGCAAAACACAGCAAGTTCCTTTACT

Function

NR:

description
PREDICTED: KN motif and ankyrin repeat domain-containing protein 2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU176810 True 284 lncRNA 0.58 1 8240376 8240659

Neighbor

gene id symbol gene type direction distance location
CI01000029_08198433_08203489 NA coding upstream 36838 8198365 ~ 8203538 (+)
CI01000029_08156225_08174249 SLC22A23 coding upstream 65240 8155914 ~ 8175136 (+)
CI01000029_08140259_08140582 NA coding upstream 99431 8140175 ~ 8140945 (+)
CI01000029_08072926_08079001 PHACTR1 coding upstream 161264 8072926 ~ 8079112 (+)
CI01000029_08053844_08058278 NA coding upstream 181855 8053844 ~ 8058521 (+)
CI01000029_08288440_08301175 NA coding downstream 47781 8288440 ~ 8301357 (+)
CI01000029_08318488_08338631 NA coding downstream 77829 8318488 ~ 8339359 (+)
CI01000029_08346604_08357224 NA coding downstream 105742 8346401 ~ 8357633 (+)
CI01000029_08367350_08368348 GPR6 coding downstream 125685 8366344 ~ 8368514 (+)
CI01000029_08425310_08441838 NA coding downstream 183138 8423797 ~ 8441847 (+)
G155716 NA non-coding upstream 3075 8236201 ~ 8237301 (+)
G155718 NA non-coding upstream 9049 8228916 ~ 8231327 (+)
G155731 NA non-coding upstream 12925 8227136 ~ 8227451 (+)
G155713 NA non-coding upstream 13818 8214359 ~ 8226558 (+)
G155698 NA non-coding upstream 85458 8154717 ~ 8154918 (+)
G155724 NA non-coding downstream 516 8241175 ~ 8241628 (+)
G155723 NA non-coding downstream 1652 8242311 ~ 8242805 (+)
G155725 NA non-coding downstream 4340 8244999 ~ 8245490 (+)
G155720 NA non-coding downstream 7830 8248489 ~ 8248713 (+)
G155753 NA non-coding downstream 133375 8374034 ~ 8374329 (+)
G155627 NA other upstream 308199 7931480 ~ 7932177 (+)
G155522 NA other upstream 602542 7634833 ~ 7637834 (+)
CI01000029_06906861_06907157 NA other upstream 1332944 6905834 ~ 6908633 (+)
G155083 NA other upstream 1750082 6431535 ~ 6490294 (+)
G155079 NA other upstream 1951978 6282685 ~ 6288398 (+)
G156007 NA other downstream 724159 8964818 ~ 9064541 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
rainbow trout (Oncorhynchus mykiss) G332906 NA non-coding NC_048568.1 CM023222.3 22648418 ~ 22649559 (-)