CI01000030_07149325_07150136 (CRYGS, CRYGS1)


Basic Information

Item Value
gene id CI01000030_07149325_07150136
gene name CRYGS, CRYGS1
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 7149325 ~ 7150210 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000030_07149325_07150136.mRNA
GCGCCACCACCAGCTGAACCTCTACAGAATGGGCCGGATCATTTTCTACGAGGACAAGAACTTCCAGGGCCGTCGGTATGAGTGCGACAGCGACTGTTCGGACTTCCATGCCTACCTGAACCGGTGTAACTCCATCCGCGTGGAGAGTGGGTCTTGGGTGGTCTATGAGAGGCCCAACTTCATGGGCTACCAGTATGTTCTGACCCGGGGCGAGTACCCAGATTACCAACGCTGGATGGGTCTGAACGACCGCCTCTGCTCCTGCAAGATGATCCACTTTGTGTCCCTTCCTCTCCAGGTAAGCGGTTCTGAGTACAAGATCCAACTCTATGACAAAGGAGATTTTGCCGGCCAGGTGTACGAGACCACCGAGGACTGTCCATCTGTGGTGGACCGCTTCCGTACACGCGAGGTCCACTCCTGTAAGGTGCTGGATGGGATCTGGATCTTCTACGAGCACCCAAACTACAGGGGGCGCCAGTACCTACTGGAGAAGGGGGAATATCGTAAGCCCGTTGACTGGGGCGCCGTCTGCCCCACGGTTCAGTCCTTCAAACGCCTACAGAGTGATGTCTGAACTGTAAATCCATCCATCTGCAGTCCTCTTTACCTGCCCAACCACAACAGCACCGACACACCTGTGCTGAATCA

Function

symbol description
crygs1 Predicted to be a structural constituent of eye lens. Predicted to be involved in lens development in camera-type eye and visual perception. Is expressed in eye and lens. Human ortholog(s) of this gene implicated in cataract 20 multiple types. Orthologous to human CRYGS (crystallin gamma S).
crygs Predicted to be a structural constituent of eye lens. Predicted to be involved in lens development in camera-type eye and visual perception. Predicted to act upstream of or within morphogenesis of an epithelium. Implicated in cataract 20 multiple types.

NR:

description
novel protein similar to vertebrate crystallin gamma S (CRYGS), partial

GO:

id name namespace
GO:0005575 cellular_component cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000030_07149325_07150136.mRNA True 651 mRNA 0.56 3 7149325 7150210

Neighbor

gene id symbol gene type direction distance location
CI01000030_07132933_07144801 KRT222 coding upstream 4348 7132555 ~ 7144977 (+)
CI01000030_07090203_07116961 PTPN4B coding upstream 32170 7090203 ~ 7117155 (+)
CI01000030_07035634_07056907 NA coding upstream 91045 7035634 ~ 7058280 (+)
CI01000030_06854630_06884768 NA coding upstream 264230 6852912 ~ 6885095 (+)
CI01000030_06807723_06810172 NA coding upstream 338828 6807723 ~ 6810497 (+)
CI01000030_07179638_07180532 METTL21A coding downstream 29339 7179549 ~ 7180616 (+)
CI01000030_07186693_07197825 DPP4 coding downstream 36483 7186693 ~ 7197825 (+)
CI01000030_07200104_07202258 GCGA coding downstream 49894 7200104 ~ 7202485 (+)
CI01000030_07205352_07214486 NA coding downstream 55142 7205352 ~ 7214552 (+)
CI01000030_07216807_07247307 GNAV1 coding downstream 66597 7216807 ~ 7247336 (+)
G161710 NA non-coding upstream 21453 7127636 ~ 7127872 (+)
G161689 NA non-coding upstream 124729 7024376 ~ 7024596 (+)
G161659 NA non-coding upstream 128603 7020350 ~ 7020722 (+)
G161663 NA non-coding upstream 129095 7019972 ~ 7020230 (+)
G161667 NA non-coding upstream 130571 7016627 ~ 7018754 (+)
G161629 NA non-coding downstream 31481 7181691 ~ 7183082 (+)
G161628 NA non-coding downstream 162036 7312246 ~ 7319998 (+)
G161653 NA non-coding downstream 170307 7320517 ~ 7320880 (+)
G161669 NA non-coding downstream 177171 7327381 ~ 7328897 (+)
G161637 NA non-coding downstream 191759 7341969 ~ 7342504 (+)
G159816 NA other upstream 2632218 4516778 ~ 4517381 (+)
G159685 NA other upstream 2660799 4431800 ~ 4488526 (+)
CI01000030_03018776_03042194 FGF22 other upstream 4105552 3018776 ~ 3043773 (+)
G158416 NA other upstream 4535032 2595876 ~ 2614293 (+)
CI01000030_02277208_02282376 TM6SF2 other upstream 4866955 2277208 ~ 2282743 (+)
CI01000030_07868597_07886123 NA other downstream 703875 7868292 ~ 7886228 (+)
G162088 NA other downstream 1087755 8237965 ~ 8239604 (+)
G161986 NA other downstream 1394372 8544582 ~ 8548325 (+)
G162137 NA other downstream 1417800 8568010 ~ 8571726 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location