G195307


Basic Information

Item Value
gene id G195307
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 873108 ~ 933608 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU221843
TTTGTGCGCCAAAAAAACAAAATAACGACTTTATCTAATAATATCCAGTGATGGGTGATTTCAAAACACTGCTTCATGAAGCTTCGAAGCTTTACGAATCTTTTGTTTTGAATCAGTGGTTCGGAGCTCCTATCAAACCGTGAAGCCTTGTTTACTGAAATCACGTGATTTTGGCGCTCTGAACCACTGATTCGAAACAAAAGATTTGTAAAGCTTTTGCCATCACTAGATATTGTTGAATAAAGTCTCCATTTTGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU221843 True 257 lncRNA 0.37 2 873108 933608

Neighbor

gene id symbol gene type direction distance location
CI01000046_00790248_00814884 MKL2B coding downstream 58224 790183 ~ 814884 (-)
CI01000046_00777923_00780186 RPC11, POLR3K, POLR3K.S coding downstream 92922 774434 ~ 780293 (-)
CI01000046_00749734_00763064 NA coding downstream 109627 749684 ~ 763481 (-)
CI01000046_00702360_00703954 NA coding downstream 169154 701939 ~ 703954 (-)
CI01000046_00690567_00697727 NA coding downstream 173236 690140 ~ 699872 (-)
CI01000046_01047300_01066367 UNKL, UNKL.S coding upstream 113601 1047209 ~ 1066367 (-)
CI01000046_01074910_01076076 GPER1 coding upstream 141190 1074798 ~ 1076424 (-)
CI01000046_01098117_01099160 GPR146 coding upstream 163650 1097258 ~ 1099160 (-)
CI01000046_01167146_01194022 BAIAP3 coding upstream 233420 1167028 ~ 1194022 (-)
CI01000046_01236373_01241067 UBE2I coding upstream 302384 1235992 ~ 1241067 (-)
G195282 NA non-coding downstream 32416 840427 ~ 840692 (-)
G195280 NA non-coding downstream 33405 839364 ~ 839703 (-)
G195115 NA non-coding downstream 103002 764897 ~ 770106 (-)
G195101 NA non-coding downstream 136552 735070 ~ 736556 (-)
G195403 NA non-coding upstream 151236 1084844 ~ 1085092 (-)
G195412 NA non-coding upstream 186116 1119724 ~ 1119925 (-)
G195421 NA non-coding upstream 209477 1143085 ~ 1143475 (-)
G195422 NA non-coding upstream 209906 1143514 ~ 1143752 (-)
G195426 NA non-coding upstream 217766 1151374 ~ 1151694 (-)
G195098 NA other downstream 196980 670736 ~ 676128 (-)
G195097 NA other downstream 446782 407423 ~ 426326 (-)
CI01000046_00063416_00065082 NA other downstream 807197 63153 ~ 65082 (-)
G196463 NA other upstream 1234658 2168266 ~ 2168644 (-)
CI01000046_02866255_02867695 MRM2, FTSJ2 other upstream 1932651 2866070 ~ 2867794 (-)
G198265 NA other upstream 2824015 3665243 ~ 3800101 (-)
G199054 NA other upstream 5163751 6097359 ~ 6097674 (-)
G199014 NA other upstream 5430570 6364178 ~ 6375406 (-)

Expression


Co-expression Network