CI01000051_03107566_03109607 (ITPA)



Basic Information


Item Value
gene id CI01000051_03107566_03109607
gene name ITPA
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 3107566 ~ 3109730 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>CI01000051_03107566_03109607.mRNA
GTAGTTCAGATCCTTGGTGACAAATTTCCCTACAAACTGATCTCTAAGAAGATTGACTTGCCTGAATATCAGGGAGAACCAGATGAGATTTCTATCCAGAAGTGTCAAGAAGCAGCAAGGCAGGTGGATGGGCCAGTGCTGGTGGAGGACACATGTCTGTGCTTCAGGGCACTAGGAGGACTACCAGGACCTTACATAAAATGGTTCTTGGATAAACTGAAGCCTGAAGGATTGTATAAATTGCTGGCAGGTTTTGAAGATAAATCAGCCTGGGCTCTGTGTACATTTGCTTTCTGTGCTGGAAAAGAGGAGCCAGTTCAGCTGTTCAGAGGAATAACCGAGGGCCGTATTGTTGAGCCCAGGGGCCCAAGGGATTTTGGATGGGATCCTTGTTTCCAGCCTGATGGTTATGAAAAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAACAGCATCTCCCATCGGTACCGCGCCCTGGCAGCCTTGTCGGAACACTTCTCCCAGCTTAACAACGCACCGGAGACCAAGCGCACAAAACACCAAGACTGAGTTCTGTTCTCTTTCCAAGCAGAATCAGCCAATCAGAGCTCAGTTTGGCTCTGGCTCAAACGAATGCACTGATGTGCTGGTCTTAAACGGTTTAAAATGTACTCCATCCTCTTTGTCTTTTAA

Function


symbol description
itpa Predicted to enable nucleoside-triphosphate diphosphatase activity. Predicted to be involved in nucleoside triphosphate catabolic process. Predicted to act upstream of or within nucleotide metabolic process. Predicted to be active in cytoplasm. Human ortholog(s) of this gene implicated in several diseases, including anemia (multiple); developmental and epileptic encephalopathy 35; hepatitis C; rheumatoid arthritis; and thrombocytopenia. Orthologous to human ITPA (inosine triphosphatase).

GO:

id name namespace
GO:0005737 cytoplasm cellular_component

KEGG:

id description
K01519 ITPA; inosine triphosphate pyrophosphatase

RNA


RNA id representative length rna type GC content exon number start site end site
CI01000051_03107566_03109607.mRNA True 672 mRNA 0.47 7 3107566 3109730

Neighbor


gene id symbol gene type direction distance location
CI01000051_03038457_03041581 PIGC coding upstream 64833 3036852 ~ 3042733 (+)
CI01000051_03022303_03035625 TMED5 coding upstream 71711 3021494 ~ 3035855 (+)
CI01000051_03014282_03014572 NA coding upstream 92805 3013677 ~ 3014761 (+)
CI01000051_02332216_02342649 PRKAA2 coding upstream 764353 2332216 ~ 2345195 (+)
CI01000051_02285060_02291993 NA coding upstream 815293 2284139 ~ 2292273 (+)
CI01000051_03128080_03133290 NA coding downstream 18350 3128080 ~ 3133321 (+)
CI01000051_03147600_03152676 MYOC coding downstream 37504 3147234 ~ 3153094 (+)
CI01000051_03431193_03432454 JUN coding downstream 320561 3430291 ~ 3432788 (+)
CI01000051_03435613_03439371 NA coding downstream 325883 3435613 ~ 3439851 (+)
CI01000051_03443548_03451188 NA coding downstream 333818 3443548 ~ 3451814 (+)
G219015 NA non-coding upstream 9777 3096824 ~ 3097789 (+)
G218992 NA non-coding upstream 34270 3071293 ~ 3073296 (+)
G218989 NA non-coding upstream 54782 3051880 ~ 3052784 (+)
G218988 NA non-coding upstream 56682 3050682 ~ 3050884 (+)
G218987 NA non-coding upstream 57121 3050219 ~ 3050445 (+)
G219019 NA non-coding downstream 13967 3123697 ~ 3123940 (+)
G218967 NA non-coding downstream 53005 3162735 ~ 3163345 (+)
G219028 NA non-coding downstream 86959 3196689 ~ 3196900 (+)
G219029 NA non-coding downstream 87255 3196985 ~ 3197298 (+)
G219040 NA non-coding downstream 110443 3220173 ~ 3224648 (+)
CI01000051_02060996_02061735 NA other upstream 1041483 2060534 ~ 2062355 (+)
CI01000051_00638200_00720543 CDC42BPB other upstream 2382862 637590 ~ 720669 (+)
G217075 NA other upstream 2723438 324465 ~ 384128 (+)
G218981 NA other downstream 135713 3245443 ~ 3246873 (+)
CI01000051_04374052_04393328 NA other downstream 1264680 4372658 ~ 4393677 (+)
G219803 NA other downstream 1805244 4914974 ~ 5052033 (+)
CI01000051_06825895_06830637 NA other downstream 3716069 6825895 ~ 6830637 (+)
G221319 NA other downstream 4232311 7342041 ~ 7342546 (+)

Expression



Co-expression Network


Homologous


species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_017204 itpa coding NC_007131.7 CM002904.2 14941264 ~ 14949443 (+)