CI01000051_05314994_05317995 (ACTC1B, ACTA2, ACTA1, MGC53823, ACTC1, MGC75582, ACT3, ACTC1A, ACTA1A, ACT2, ACTC1.L)



Basic Information


Item Value
gene id CI01000051_05314994_05317995
gene name ACTC1B, ACTA2, ACTA1, MGC53823, ACTC1, MGC75582, ACT3, ACTC1A, ACTA1A, ACT2, ACTC1.L
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 5314444 ~ 5318185 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>CI01000051_05314994_05317995.mRNA
GTATAAATTGGCTGCGGCTCAAGGCGGTGTCTACCATTCACTCTCCAAGGGAACCAGCTCCTGGTGCTGATCTGGTAAGTACAGCTAAAGCTTTCAGAAATGTCAGACTTCATTTAATGGGATGATCTTCTGAACGCTAGGATTTAAACTAGGCCAGTTCTGGTGCAACATCGCTGGAATTATAATGAAAATAATTGACTGTTGAGCTAAACAAATATTTCAGGGGCTTAAGAGTTGCCAGTTAAGAATACTTTGCTTTGAGTTTCAAAAATGTTATTAATGTTCTTTTGAAACTTTGTCATGAGGAAAGTCAAAGATGAGCATGTCAACATTTCATGAGGTTCTTAACTAAAACTGGTACTGAACTGTTTTTGCTCTGAAGAACATTTTTATTTTATTTTATGAGTGTATGGAGAAGAATTTTAGATGGGTTGGTGGTCTTTTCTGATGAGAAAGCGTGAGCCTGACAGGAATGCAAACTAAATGACTTGGATGTTTGCAGTATGTTCAGACATGTATCTGATCCTCATATAGAACCCCAGCTGACACCATGTGTGACGACGATGAGACCACCGCTCTTGTGTGCGACAATGGCTCCGGCCTGGTGAAGGCTGGCTTTGCCGGAGATGATGCGCCTCGTGCTGTTTTCCCCTCCATTGTTGGTCGTCCTCGCCACCAGGGTGTCATGGTAGGTATGGGACAGAAAGACTCCTACGTGGGTGATGAGGCCCAGAGCAAGAGAGGTATCCTGACGTTGAAGTATCCAATCGAGCACGGTATTATCACCAACTGGGATGATATGGAGAAGATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCCCCTGAGGAACATCCCACACTGCTCACTGAGGCTCCTCTTAACCCCAAGGCCAACAGAGAGAAGATGACACAGATCATGTTTGAGACGTTCAATGTTCCTGCCATGTATGTGGCCATCCAGGCTGTGCTGTCACTATATGCCTCTGGCCGTACCACTGGTATTGTGCTGGACTCTGGAGATGGTGTGACCCACAATGTCCCCATCTACGAGGGTTATGCTCTGCCCCACGCCATTATGCGTCTGGATCTGGCTGGTCGCGATCTGACTGACTACCTGATGAAGATCCTGACTGAGCGAGGCTACTCTTTTGTGACCACTGCTGAGCGTGAGATTGTGCGTGACATAAAGGAGAAGCTGTGCTACGTCGCTCTGGACTTTGAGAATGAAATGGCCACTGCTGCTTCCTCCTCTTCCCTGGAGAAGTCCTACGAGTTGCCTGATGGCCAGGTCATCACTATCGGAAATGAACGTTTCCGTTGCCCCGAGACCCTCTTCCAGCCTTCCTTCATTGGTATGGAGTCTGCTGGTATCCATGAGACCACCTACAACAGCATCATGAAGTGCGACATCGATATCCGTAAGGACTTGTATGCCAACAACGTCCTGTCTGGTGGCACCACCATGTACCCAGGTATTGCTGATCGTATGCAGAAGGAGATCACTGCTCTGGCCCCCAGCACCATGAAGATCAAGATCATCGCTCCCCCTGAGCGCAAGTACTCCGTCTGGATCGGTGGCTCCATTCTGGCTTCCCTGTCCACCTTTCAGCAAATGTGGATCAGCAAGCAGGAATACGATGAGGCTGGCCCATCCATCGTCCACAGGAAGTGCTTCTAAGTGCCATATTACACTGCTGATTATGGATGCAAAAAACAGAAATTCTCAACATTACCTCCGCCTGTTATGCATGCAGGCAGATTTTGCCTTTTTTTTCCATGTACAGTATGTTTACACCAAAGTGCAATTTGTTTGTAGTTATTTACTGGTTCAGAACAAAATTTGTATGTGAATATTTATTGGTTTTTAA

Function


symbol description
actc1b Predicted to be part of dynactin complex. Is expressed in several structures, including EVL; mesoderm; musculature system; pericardial region; and trunk. Used to study nemaline myopathy. Human ortholog(s) of this gene implicated in atrial heart septal defect 5; dilated cardiomyopathy; dilated cardiomyopathy 1R; and hypertrophic cardiomyopathy 11. Orthologous to human ACTC1 (actin alpha cardiac muscle 1).
acta2 Acts upstream of or within heart contraction. Predicted to be located in several cellular components, including cell body; filopodium; and lamellipodium. Predicted to be part of dynactin complex. Is expressed in several structures, including cardiovascular system; gut; mesoderm; musculature system; and swim bladder. Human ortholog(s) of this gene implicated in Moyamoya disease; megacystis-microcolon-intestinal hypoperistalsis syndrome; and thoracic aortic aneurysm. Orthologous to several human genes including ACTA2 (actin alpha 2, smooth muscle).
actc1a Acts upstream of or within atrioventricular canal development and endocardial cushion formation. Predicted to be part of dynactin complex. Is expressed in adaxial cell; brain; muscle; pericardial region; and trunk. Human ortholog(s) of this gene implicated in atrial heart septal defect 5; dilated cardiomyopathy; dilated cardiomyopathy 1R; and hypertrophic cardiomyopathy 11. Orthologous to human ACTC1 (actin alpha cardiac muscle 1).
acta1a Acts upstream of or within skeletal muscle fiber development. Predicted to be located in several cellular components, including cell body; filopodium; and lamellipodium. Predicted to be part of dynactin complex. Is expressed in several structures, including adaxial cell; fin; musculature system; pericardial region; and trunk. Human ortholog(s) of this gene implicated in congenital fiber-type disproportion and nemaline myopathy 3. Orthologous to human ACTA1 (actin alpha 1, skeletal muscle).
acta1 Predicted to enable ADP binding activity; ATP binding activity; and myosin binding activity. Predicted to be a structural constituent of cytoskeleton. Involved in skeletal muscle thin filament assembly. Located in actin filament; stress fiber; and striated muscle thin filament. Implicated in congenital fiber-type disproportion and nemaline myopathy 3.
actc1 Enables ATP binding activity; microfilament motor activity; and myosin binding activity. Involved in actin-myosin filament sliding and heart contraction. Located in actin filament and sarcomere. Implicated in atrial heart septal defect 5; dilated cardiomyopathy; dilated cardiomyopathy 1R; and hypertrophic cardiomyopathy 11.

GO:

id name namespace
GO:0009991 response to extracellular stimulus biological_process

KEGG:

id description
K12314 ACTC1; actin, alpha cardiac muscle

RNA


RNA id representative length rna type GC content exon number start site end site
CI01000051_05314994_05317995.mRNA True 1874 mRNA 0.47 7 5314444 5318185

Neighbor


gene id symbol gene type direction distance location
CI01000051_05296858_05301152 NA coding upstream 13110 5296684 ~ 5301334 (+)
CI01000051_05254556_05270993 MEIS2B, MEIS2 coding upstream 42616 5254556 ~ 5271828 (+)
CI01000051_05174862_05175926 NA coding upstream 137937 5174108 ~ 5176507 (+)
CI01000051_05126681_05142536 NA coding upstream 171827 5125751 ~ 5142617 (+)
CI01000051_05072860_05074568 GLRX5 coding upstream 239570 5072629 ~ 5074874 (+)
CI01000051_05320361_05322570 GJD2B, GJD2 coding downstream 2176 5320361 ~ 5323905 (+)
CI01000051_05401881_05405868 NA coding downstream 83696 5401881 ~ 5405886 (+)
CI01000051_05454570_05480649 NA coding downstream 136347 5454532 ~ 5480935 (+)
CI01000051_05514127_05516929 ZFP36L1B, ZFP36L1 coding downstream 194571 5512756 ~ 5517785 (+)
CI01000051_05523573_05525861 NA coding downstream 205177 5523362 ~ 5527007 (+)
G220730 NA non-coding upstream 108816 5205426 ~ 5205628 (+)
G220727 NA non-coding upstream 111693 5202409 ~ 5202751 (+)
G220726 NA non-coding upstream 114760 5199405 ~ 5199684 (+)
G220725 NA non-coding upstream 115447 5198774 ~ 5198997 (+)
G220701 NA non-coding upstream 136877 5177338 ~ 5177567 (+)
G220773 NA non-coding downstream 30622 5348807 ~ 5406672 (+)
G220807 NA non-coding downstream 57497 5375682 ~ 5376525 (+)
G220830 NA non-coding downstream 114759 5432944 ~ 5433210 (+)
G220844 NA non-coding downstream 165320 5483505 ~ 5484126 (+)
G220846 NA non-coding downstream 167293 5485478 ~ 5485721 (+)
G219803 NA other upstream 262411 4914974 ~ 5052033 (+)
CI01000051_04374052_04393328 NA other upstream 939114 4372658 ~ 4393677 (+)
G218981 NA other upstream 2067571 3245443 ~ 3246873 (+)
CI01000051_02060996_02061735 NA other upstream 3248361 2060534 ~ 2062355 (+)
CI01000051_00638200_00720543 CDC42BPB other upstream 4589740 637590 ~ 720669 (+)
CI01000051_06825895_06830637 NA other downstream 1507614 6825895 ~ 6830637 (+)
G221319 NA other downstream 2023856 7342041 ~ 7342546 (+)
G221386 NA other downstream 2091338 7401175 ~ 7413007 (+)
CI01000051_08211233_08214513 NA other downstream 2787458 8209722 ~ 8214696 (+)
G222727 NA other downstream 3024757 8342942 ~ 8343448 (+)

Expression



Co-expression Network


Homologous


species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_017927 ACTC1 coding NC_007131.7 CM002904.2 9970786 ~ 9980318 (-)