CI01000051_05757566_05757955 (C12ORF57)


Basic Information

Item Value
gene id CI01000051_05757566_05757955
gene name C12ORF57
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 5757566 ~ 5758141 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000051_05757566_05757955.mRNA
TTGTTCTCAGTGAGGTGATCCAGGCTTTCTCTGTGCCTGAGAACGCCGCCCGCATGGAGGAAGCCAGAGAAAGCGCCTGCAATGACATGGGCAAGATGCTGCAGCTCGTGCTTCCCGTAGCCACTCAGATCCAACAGGAGGTCATCAAAGCATATGGCTTCAACAATGAGGGAGAAGGTGTTCTCAAATTCGCCCGGCTGGTAAAGATGTATGAAACTCAGGACCCAGAGATCGCAGCCATGTCAGTGAAACTCAAGAGTCTCCTACTGCCGCCTCTCTCCACTCCTCCCATTGGCAGTGGCATCCCGACCTCATAGAACAAGCCCAAACTCCCCGTTCATAAAGTTCAAAACCGTTTCAACTATAAAAATTGTATAGTGCGAACACATTTAGGGTATCCAAAATATGATCTAGATTTTAGTCTGTTTTAACACTTCTTTCAAGGGTCATTTAAACTGAGGTGAAGTGAATTTTCTCAGACCACAGAAAAAATATTTAAGTTA

Function

symbol description
c12orf57 Involved in several processes, including animal organ development; psychomotor behavior; and regulation of skeletal muscle contraction. Located in cytoplasm and nuclear speck. Implicated in Temtamy syndrome.

GO:

id name namespace
GO:0005737 cytoplasm cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000051_05757566_05757955.mRNA True 503 mRNA 0.46 2 5757566 5758141

Neighbor

gene id symbol gene type direction distance location
CI01000051_05712567_05728993 YLPM1 coding upstream 27875 5712567 ~ 5729691 (+)
CI01000051_05657394_05672861 SYT14B, SYT14 coding upstream 83364 5657394 ~ 5674202 (+)
CI01000051_05588671_05593438 RDH14B coding upstream 163589 5588292 ~ 5593977 (+)
CI01000051_05579061_05584087 CRIP2 coding upstream 173479 5579061 ~ 5584087 (+)
CI01000051_05523573_05525861 NA coding upstream 230559 5523362 ~ 5527007 (+)
CI01000051_05831209_05933202 DLGAP2 coding downstream 73068 5831209 ~ 5933637 (+)
CI01000051_05935542_05939529 NA coding downstream 177302 5935443 ~ 5939632 (+)
CI01000051_05955881_05966250 NA coding downstream 197276 5955417 ~ 5966425 (+)
CI01000051_05969849_05970699 NA coding downstream 211708 5969849 ~ 5971469 (+)
CI01000051_05996289_06007664 RHAG coding downstream 237854 5995995 ~ 6008558 (+)
G220916 NA non-coding upstream 13101 5741058 ~ 5744465 (+)
G220930 NA non-coding upstream 17395 5739579 ~ 5740171 (+)
G220922 NA non-coding upstream 80603 5676464 ~ 5676963 (+)
G220889 NA non-coding upstream 185829 5571458 ~ 5571737 (+)
G220861 NA non-coding upstream 234780 5521857 ~ 5522786 (+)
G220923 NA non-coding downstream 31387 5789528 ~ 5830106 (+)
G220920 NA non-coding downstream 187449 5945590 ~ 5946344 (+)
G220983 NA non-coding downstream 231665 5989806 ~ 5990114 (+)
G220967 NA non-coding downstream 257032 6015173 ~ 6016182 (+)
G220991 NA non-coding downstream 261180 6019321 ~ 6019978 (+)
G219803 NA other upstream 705533 4914974 ~ 5052033 (+)
CI01000051_04374052_04393328 NA other upstream 1382236 4372658 ~ 4393677 (+)
G218981 NA other upstream 2510693 3245443 ~ 3246873 (+)
CI01000051_02060996_02061735 NA other upstream 3691483 2060534 ~ 2062355 (+)
CI01000051_00638200_00720543 CDC42BPB other upstream 5032862 637590 ~ 720669 (+)
CI01000051_06825895_06830637 NA other downstream 1067658 6825895 ~ 6830637 (+)
G221319 NA other downstream 1583900 7342041 ~ 7342546 (+)
G221386 NA other downstream 1651382 7401175 ~ 7413007 (+)
CI01000051_08211233_08214513 NA other downstream 2347502 8209722 ~ 8214696 (+)
G222727 NA other downstream 2584801 8342942 ~ 8343448 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
bowfin (Amia calva) AMCG00004029 cssa15h12orf57,grcc10,clg18h12orf57,csgr04h12orf57,c7h12orf57,LOC107695984,LOC105901913,LOC103359244 coding CM030121.1 CM030121.1 30201188 ~ 30202790 (+)