G218200


Basic Information

Item Value
gene id G218200
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 2208530 ~ 2208788 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU247516
GCCAGGGGTGCTTTTTTGGTCTTGTTCTCAAGGGAGCACCTGGAGATGTTGCTTGGTAATTAAACTTTACGTGACACACTTATCCTAAAAGCTGTCCTCATCACTTTCCTCCTGACTGCTTTCCTCACTATCTTCTTTTCTCTCAAACATGGTAGAATGATGATAATGATTTTTTAAAAAAATTTTATTTTACTAACATTAATGACACAGACAACAGCAAGAATATTAGGCTGCTGTCACTTTAAGAAGGAAAGCACGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU247516 True 259 lncRNA 0.38 1 2208530 2208788

Neighbor

gene id symbol gene type direction distance location
CI01000051_02060996_02061735 NA coding upstream 146175 2060534 ~ 2062355 (+)
CI01000051_01976321_01985259 PCSK9 coding upstream 222371 1976080 ~ 1986159 (+)
CI01000051_01965924_01969562 NA coding upstream 238928 1965703 ~ 1969602 (+)
CI01000051_01945810_01948306 NA coding upstream 260044 1945810 ~ 1948486 (+)
CI01000051_01765268_01780393 NA coding upstream 426116 1765035 ~ 1782414 (+)
CI01000051_02280290_02283028 NA coding downstream 71502 2280290 ~ 2283368 (+)
CI01000051_02285060_02291993 NA coding downstream 75351 2284139 ~ 2292273 (+)
CI01000051_02332216_02342649 PRKAA2 coding downstream 123428 2332216 ~ 2345195 (+)
CI01000051_03014282_03014572 NA coding downstream 804889 3013677 ~ 3014761 (+)
CI01000051_03022303_03035625 TMED5 coding downstream 812706 3021494 ~ 3035855 (+)
G218197 NA non-coding upstream 3397 2204812 ~ 2205133 (+)
G218150 NA non-coding upstream 29005 2121922 ~ 2179525 (+)
G218149 NA non-coding upstream 86946 2121280 ~ 2121584 (+)
G218129 NA non-coding upstream 132890 2075416 ~ 2075640 (+)
G218118 NA non-coding upstream 155380 2052554 ~ 2053150 (+)
G218215 NA non-coding downstream 22274 2231062 ~ 2231269 (+)
G218271 NA non-coding downstream 161368 2370156 ~ 2411944 (+)
G218237 NA non-coding downstream 286766 2495554 ~ 2557151 (+)
G218342 NA non-coding downstream 365603 2574391 ~ 2574605 (+)
CI01000051_00638200_00720543 CDC42BPB other upstream 1483826 637590 ~ 720669 (+)
G217075 NA other upstream 1824402 324465 ~ 384128 (+)
G218981 NA other downstream 1036655 3245443 ~ 3246873 (+)
CI01000051_04374052_04393328 NA other downstream 2165622 4372658 ~ 4393677 (+)
G219803 NA other downstream 2706186 4914974 ~ 5052033 (+)
CI01000051_06825895_06830637 NA other downstream 4617011 6825895 ~ 6830637 (+)
G221319 NA other downstream 5133253 7342041 ~ 7342546 (+)

Expression


Co-expression Network