G219895


Basic Information

Item Value
gene id G219895
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 5144671 ~ 5144882 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU249409
GGAGGCGAGGAGCGAGGAGTGAGGAAGCTTCCTGAGGAGTTATGAGTGAGGATACACAGGTGTATCCTTTGCGGAAGTCTTTCTAGTCTAGTTGAGAAACCTGACGCACGTATACATTCTCCTCCCCCGTCACATTTGTCAACAATAATTTAAATGTATTCTTTACTTTTGCAGTTTAAATAAACTTTACATCTCATATATTTCAGCAGGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU249409 True 212 lncRNA 0.42 1 5144671 5144882

Neighbor

gene id symbol gene type direction distance location
CI01000051_05126681_05142536 NA coding upstream 2054 5125751 ~ 5142617 (+)
CI01000051_05072860_05074568 GLRX5 coding upstream 69797 5072629 ~ 5074874 (+)
CI01000051_04796878_04799272 FLRT2 coding upstream 345350 4796878 ~ 4799321 (+)
CI01000051_04763063_04778692 NA coding upstream 365589 4762496 ~ 4779082 (+)
CI01000051_04419475_04464134 NA coding upstream 680505 4419270 ~ 4464166 (+)
CI01000051_05174862_05175926 NA coding downstream 29226 5174108 ~ 5176507 (+)
CI01000051_05254556_05270993 MEIS2B, MEIS2 coding downstream 109674 5254556 ~ 5271828 (+)
CI01000051_05296858_05301152 NA coding downstream 151802 5296684 ~ 5301334 (+)
CI01000051_05314994_05317995 ACTC1B, ACTA2, ACTA1, MGC53823, ACTC1, MGC75582, ACT3, ACTC1A, ACTA1A, ACT2, ACTC1.L coding downstream 169562 5314444 ~ 5318185 (+)
CI01000051_05320361_05322570 GJD2B, GJD2 coding downstream 175479 5320361 ~ 5323905 (+)
G219881 NA non-coding upstream 39524 5104922 ~ 5105147 (+)
G219880 NA non-coding upstream 40915 5103527 ~ 5103756 (+)
G219877 NA non-coding upstream 48471 5095978 ~ 5096200 (+)
G219806 NA non-coding upstream 72534 5071617 ~ 5072137 (+)
G220701 NA non-coding downstream 32456 5177338 ~ 5177567 (+)
G220725 NA non-coding downstream 53892 5198774 ~ 5198997 (+)
G220726 NA non-coding downstream 54523 5199405 ~ 5199684 (+)
G220727 NA non-coding downstream 57527 5202409 ~ 5202751 (+)
G220730 NA non-coding downstream 60544 5205426 ~ 5205628 (+)
G219803 NA other upstream 92638 4914974 ~ 5052033 (+)
CI01000051_04374052_04393328 NA other upstream 769341 4372658 ~ 4393677 (+)
G218981 NA other upstream 1897798 3245443 ~ 3246873 (+)
CI01000051_02060996_02061735 NA other upstream 3078588 2060534 ~ 2062355 (+)
CI01000051_00638200_00720543 CDC42BPB other upstream 4419967 637590 ~ 720669 (+)
CI01000051_06825895_06830637 NA other downstream 1680917 6825895 ~ 6830637 (+)
G221319 NA other downstream 2197159 7342041 ~ 7342546 (+)
G221386 NA other downstream 2264641 7401175 ~ 7413007 (+)
CI01000051_08211233_08214513 NA other downstream 2960761 8209722 ~ 8214696 (+)
G222727 NA other downstream 3198060 8342942 ~ 8343448 (+)

Expression


Co-expression Network