G221280


Basic Information

Item Value
gene id G221280
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 7161166 ~ 7161367 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU250996
ATTTAACCGGACAATATTTATTTTTACTGTAAAATATCCTACATTTAAAAAGTTTTGTGAATAATAATGAATTATAAATATTTACGGTAAAATCATTTTTAGATAACAAAACAATACATGTTCTCATCTCATTAAAACGTAAAATCGAAATAGCCTACATTACATTAAAACGTAAAAACATTAAAACGTCAAAACAAACGGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU250996 True 202 lncRNA 0.23 1 7161166 7161367

Neighbor

gene id symbol gene type direction distance location
CI01000051_07125875_07127476 CLDN20 coding upstream 33319 7125875 ~ 7127847 (+)
CI01000051_07081085_07109551 TIAM2 coding upstream 51560 7081085 ~ 7109606 (+)
CI01000051_07015896_07020569 NA coding upstream 140552 7015383 ~ 7020614 (+)
CI01000051_06985393_07011299 CNKSR3 coding upstream 149763 6983354 ~ 7011403 (+)
CI01000051_06970612_06971675 NA coding upstream 189324 6970422 ~ 6971842 (+)
CI01000051_07170752_07194524 NA coding downstream 9385 7170752 ~ 7194524 (+)
CI01000051_07215332_07217167 NA coding downstream 53965 7215332 ~ 7217708 (+)
CI01000051_07253002_07255432 PTGFR coding downstream 90834 7252201 ~ 7255620 (+)
CI01000051_07259968_07261598 BT3L4, BTF3L4 coding downstream 98351 7259718 ~ 7261731 (+)
CI01000051_07267084_07283654 ZFYVE9B coding downstream 105644 7267011 ~ 7284015 (+)
G221256 NA non-coding upstream 9071 7043663 ~ 7152095 (+)
G221254 NA non-coding upstream 213271 6947384 ~ 6947895 (+)
G221208 NA non-coding upstream 249455 6847641 ~ 6911711 (+)
G221188 NA non-coding upstream 364560 6794991 ~ 6796606 (+)
G221194 NA non-coding upstream 367230 6785486 ~ 6793936 (+)
G221283 NA non-coding downstream 46004 7207371 ~ 7207573 (+)
G221351 NA non-coding downstream 61350 7222717 ~ 7222987 (+)
G221353 NA non-coding downstream 63523 7224890 ~ 7225167 (+)
G221360 NA non-coding downstream 86803 7248170 ~ 7248498 (+)
CI01000051_06825895_06830637 NA other upstream 328098 6825895 ~ 6830637 (+)
G219803 NA other upstream 2109133 4914974 ~ 5052033 (+)
CI01000051_04374052_04393328 NA other upstream 2785836 4372658 ~ 4393677 (+)
G218981 NA other upstream 3914293 3245443 ~ 3246873 (+)
CI01000051_02060996_02061735 NA other upstream 5095083 2060534 ~ 2062355 (+)
G221319 NA other downstream 180674 7342041 ~ 7342546 (+)
G221386 NA other downstream 248156 7401175 ~ 7413007 (+)
CI01000051_08211233_08214513 NA other downstream 944276 8209722 ~ 8214696 (+)
G222727 NA other downstream 1181575 8342942 ~ 8343448 (+)

Expression


Co-expression Network