G231004


Basic Information

Item Value
gene id G231004
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 3089984 ~ 3090270 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU262179
AGCTCAGTGGTTAGAGCATGGCACTAGCAATGTCAAGGTCATGGGTTCGCTCCCAGGGATTGCACATACTCAGATACAAATGTATAGTATAATGCAATGTAAGTCGCTTTGGATAAAAGCGTCTGCCAAATGCATAAATGTAAATGTAAAATGTAAAAAAAATCCAACAGGTGCTGATGAGCAAAACTTAATGCTTATCAAAAGAACACAAAACTGCATCAATGAAATCCATAAAGTCAGTCCTGTCACACAGGAAATTATTAAATAAAAATTTACTATTTGAGGAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU262179 True 287 lncRNA 0.36 1 3089984 3090270

Neighbor

gene id symbol gene type direction distance location
CI01000054_03082593_03087260 SFPQ coding downstream 2439 3082348 ~ 3087545 (-)
CI01000054_03049995_03054032 NA coding downstream 35952 3049864 ~ 3054032 (-)
CI01000054_03032517_03047094 ZMYM4 coding downstream 42890 3031826 ~ 3047094 (-)
CI01000054_03018229_03030984 NA coding downstream 59000 3018076 ~ 3030984 (-)
CI01000054_02999099_03015534 NA coding downstream 74450 2998780 ~ 3015534 (-)
CI01000054_03485424_03500327 NA coding upstream 394558 3484828 ~ 3500489 (-)
CI01000054_03918853_03925416 NA coding upstream 828128 3918398 ~ 3925416 (-)
CI01000054_03964701_03964965 NA coding upstream 874420 3964690 ~ 3964965 (-)
CI01000054_03998494_04025965 NA coding upstream 908148 3998418 ~ 4026082 (-)
CI01000054_04067809_04076131 NA coding upstream 977529 4067799 ~ 4076762 (-)
G231003 NA non-coding downstream 33044 3056728 ~ 3056940 (-)
G230910 NA non-coding downstream 46140 2950781 ~ 3043844 (-)
G230922 NA non-coding downstream 110530 2918027 ~ 2979454 (-)
G231001 NA non-coding downstream 172187 2917235 ~ 2917797 (-)
G230913 NA non-coding downstream 223344 2863400 ~ 2866640 (-)
G231010 NA non-coding upstream 25905 3116175 ~ 3116434 (-)
G231016 NA non-coding upstream 49050 3139320 ~ 3139613 (-)
G231096 NA non-coding upstream 121786 3212056 ~ 3258021 (-)
G231144 NA non-coding upstream 217802 3308072 ~ 3308359 (-)
G231151 NA non-coding upstream 225145 3315415 ~ 3315625 (-)
G230908 NA other downstream 26641 3057648 ~ 3063343 (-)
CI01000054_02857402_02860451 NA other downstream 229411 2857402 ~ 2860573 (-)
G230923 NA other downstream 252302 2837237 ~ 2837682 (-)
G230178 NA other downstream 1859849 1185533 ~ 1230135 (-)
G231645 NA other upstream 891577 3981847 ~ 3982823 (-)
CI01000054_04671351_04681181 PEF1 other upstream 1579881 4670151 ~ 4681361 (-)
G232274 NA other upstream 2115929 5206199 ~ 5209240 (-)
CI01000054_06629482_06641861 TRIQK other upstream 3537812 6628082 ~ 6642160 (-)
CI01000054_07165957_07169539 HEYL other upstream 4075165 7165435 ~ 7169539 (-)

Expression


Co-expression Network