G306488


Basic Information

Item Value
gene id G306488
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 5130123 ~ 5130512 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU348243
ATAAAAGTTGTGCATTAGGAGTGTTACTGTTTGCTTCACTTAAACTATATTTAAACATTCAAAGCTTAAGCACAACCCTCCTATACTTAATTTTCCGCGTTCCGCTCTGTTTCGCTCACAGTTGAGTGCTCGAGCCTTACAAAGTATTCTCCTGTGTCCATGAGCGCAGAAAGATGCATTCCACGTATGCGCACTATCTAGTGGACTTTGTTTTCATGCCCTCAAGTCATTCACGTATGCGCTGTTCTTCTTCTGCTCTTTTTCCTGTTGTGGCAGTTAGCAAACAGCATTGCATTACCGCGCATGCCCCCTTCTGGATTGGAGCGTGGATCGCCCATAACTGACTCTATTCGTTGTCTGATCGCGTGCACCGAACTGTGAAGGTTCAGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU348243 True 390 lncRNA 0.45 1 5130123 5130512

Neighbor

gene id symbol gene type direction distance location
CI01000092_05026383_05029730 NA coding upstream 98927 5026071 ~ 5031196 (+)
CI01000092_05020449_05021191 NA coding upstream 108303 5018705 ~ 5021820 (+)
CI01000092_04981384_04996796 NA coding upstream 133087 4981384 ~ 4997036 (+)
CI01000092_04939414_04942110 NA coding upstream 187985 4938881 ~ 4942138 (+)
CI01000092_04904673_04935963 IFT80 coding upstream 193936 4904673 ~ 4936187 (+)
CI01000092_05248296_05250920 NA coding downstream 117500 5248012 ~ 5250995 (+)
CI01000092_05368233_05369612 NA coding downstream 237721 5368233 ~ 5369996 (+)
G306486 NA non-coding upstream 2020 5127809 ~ 5128103 (+)
G306284 NA non-coding upstream 113071 5001455 ~ 5017052 (+)
G306425 NA non-coding upstream 170818 4959054 ~ 4959305 (+)
G306422 NA non-coding upstream 174341 4955570 ~ 4955782 (+)
G306420 NA non-coding upstream 177403 4952490 ~ 4952720 (+)
G306489 NA non-coding downstream 470 5130982 ~ 5131379 (+)
G306490 NA non-coding downstream 1776 5132288 ~ 5132514 (+)
G306492 NA non-coding downstream 2555 5133067 ~ 5133384 (+)
G306494 NA non-coding downstream 3480 5133992 ~ 5134219 (+)
G306495 NA non-coding downstream 4120 5134632 ~ 5134882 (+)
G305596 NA other upstream 1268790 3726347 ~ 3863135 (+)
G305584 NA other upstream 1462158 3667308 ~ 3667965 (+)
G304938 NA other upstream 2811889 2317792 ~ 2318234 (+)
G303768 NA other upstream 3813600 1315443 ~ 1316523 (+)

Expression


Co-expression Network