AMCG00014848 (tmprss3,LOC107748899)


Basic Information

Item Value
gene id AMCG00014848
gene name tmprss3,LOC107748899
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 36295716 ~ 36297723 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00014848
GTCTTGTGGAACCAATTTGTCTACCTAACTATGGTGAAGAGTTTGAAGATGGGAAAATGTGCTGGATTTCAGGCTGGGGTGCAACAGATGATGGTGGAGAAGCAACTGTGTCTATGAATTATGCCCGAGTTCCTCTGATCTCTAACAAAGTGTGCAGCCAGCCTACTGTGTACCAGGGCTTTATCACTCCACGGATGATCTGTGCTGGTTATTTGGAAGGGGGTACTGATTCTTGCCAGGGAGACAGCGGAGGTCCTCTGGCATGCAAAGATTCCTCTTTGTGGAAACTGGTGGGTGCCACAAGCTGGGGACTGGGCTGTGCAGAGCGCAACAAACCAGGAGTGTACACCAGGATCACACAATGTCTGGACTGGATCCATGAGCAGATG

Function

symbol description
tmprss3 Enables sodium channel regulator activity. Acts upstream of or within cellular sodium ion homeostasis. Located in endoplasmic reticulum membrane. Implicated in autosomal recessive nonsyndromic deafness 8 and sensorineural hearing loss. Biomarker of pancreatic ductal carcinoma.

NR:

description
PREDICTED: transmembrane protease serine 3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00014848 True 389 mRNA 0.50 3 36295716 36297723

Neighbor

gene id symbol gene type direction distance location
AMCG00014837 NA coding upstream 743909 35551157 ~ 35551807 (+)
AMCG00014834 NA coding upstream 821347 35464001 ~ 35474369 (+)
AMCG00014835 NA coding upstream 912813 35370984 ~ 35382903 (+)
AMCG00014833 NA coding upstream 974734 35027857 ~ 35320982 (+)
AMCG00014831 NA coding upstream 1363856 34691085 ~ 34931860 (+)
AMCG00014850 NA coding downstream 319942 36617665 ~ 36733253 (+)
AMCG00014852 NA coding downstream 615677 36913400 ~ 36914503 (+)
AMCG00014853 cyh2,cyth4,LOC107558519,LOC107555099 coding downstream 702907 37000630 ~ 37030062 (+)
AMCG00014862 NA coding downstream 1398937 37696660 ~ 37706352 (+)
AMCG00014864 NA coding downstream 1456072 37753795 ~ 37754523 (+)
G73616 NA non-coding upstream 37248 36258228 ~ 36258468 (+)
G73608 NA non-coding upstream 101401 36194050 ~ 36194315 (+)
G73525 NA non-coding upstream 197768 36097280 ~ 36097948 (+)
G73471 NA non-coding upstream 552869 35740535 ~ 35742847 (+)
G73463 NA non-coding upstream 611558 35674973 ~ 35684158 (+)
G73619 LOC107575789 non-coding downstream 6861 36304584 ~ 36349056 (+)
G73638 NA non-coding downstream 178885 36476608 ~ 36477950 (+)
G73641 NA non-coding downstream 192460 36490183 ~ 36500130 (+)
G73689 NA non-coding downstream 357232 36654955 ~ 36689065 (+)
G73739 NA non-coding downstream 474762 36772485 ~ 36772741 (+)
AMCG00014836 NA other upstream 883129 35390634 ~ 35412587 (+)
G73343 NA other upstream 1335269 34942011 ~ 34960447 (+)
G73329 NA other upstream 1515126 34780122 ~ 34780590 (+)
G73292 LOC100846954 other upstream 2056316 34238934 ~ 34239400 (+)
G73244 NA other upstream 2929616 33364755 ~ 33366100 (+)
G73850 NA other downstream 1220385 37518108 ~ 37518406 (+)
G74114 NA other downstream 2134651 38432374 ~ 38432861 (+)
G74227 NA other downstream 2512970 38810693 ~ 38811128 (+)
G74348 NA other downstream 3038545 39336268 ~ 39475819 (+)
AMCG00014909 ankrd54 other downstream 3286315 39584038 ~ 39588507 (+)

Expression


Co-expression Network