G64356 (hmcn2,LOC107570300,LOC107723245,LOC107659581)


Basic Information

Item Value
gene id G64356
gene name hmcn2,LOC107570300,LOC107723245,LOC107659581
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056706.1
NCBI id CM032075.1
chromosome length 24299999
location 15290269 ~ 15290491 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU95184
TGGTATGAGTAAACTGGCAGTCATCTTAAACTCCAGGCTGAGAGTGAAAAAGCTATATGTGCTACTTATTCCCGTCAGTCTGAGGAGCTGAAGCAGGGGCCCCTGACGGTTCTCCGGCCCTTCAAAAACCACAGAATGATTGCATCGAAGGGTCAAAGGAGCCCCATCCCACATGTGATTCTGTGAGGACCAGGAATAAAGCTGCCCGGAGCCTGTCTGCACA

Function

symbol description
hmcn2 Predicted to enable calcium ion binding activity. Acts upstream of or within several processes, including embryonic medial fin morphogenesis; mesenchymal cell migration; and skin morphogenesis. Is expressed in several structures, including axis; median fin fold; mesoderm; myotome; and trunk. Orthologous to human HMCN2 (hemicentin 2).

NR:

description
PREDICTED: hemicentin-1-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU95184 True 223 lncRNA 0.51 1 15290269 15290491

Neighbor

gene id symbol gene type direction distance location
LOC122350063 rfesd,LOC107711828,LOC559859,LOC107580528 coding downstream 97333 15190586 ~ 15192936 (-)
si:dkey-164f24.2 LOC107667555,LOC107723247,LOC107570302,LOC107711905 coding downstream 101625 15180268 ~ 15188644 (-)
lipg LOC107738997,LOC107565987,LOC107711901,LOC107686385,LOC107599989,LOC107667539 coding downstream 125208 15160154 ~ 15165061 (-)
ipo11 ipo11 coding downstream 143842 15026090 ~ 15146427 (-)
rnf180a rnf180,LOC107667512,LOC107599991,LOC107711845,LOC106584965 coding downstream 291663 14993384 ~ 14998606 (-)
zgc:194839 LOC107659596,LOC107686408,LOC107723116,LOC107723115,LOC107575379,LOC107723246,LOC107723230,LOC107667514,LOC107570299 coding upstream 7134 15297625 ~ 15300723 (-)
ralgps1 ralgps1,LOC107727327,LOC107669254,LOC108412534,LOC107723240 coding upstream 17246 15307737 ~ 15390751 (-)
LOC122350755 zbtb34,LOC107723248,LOC107550586,LOC107727329,LOC107564041,LOC107727326 coding upstream 102858 15393349 ~ 15407170 (-)
lmx1bb lmx1bb,lmx1b,LOC107550585,LOC107723253,LOC107753135,LOC107564042 coding upstream 206002 15496493 ~ 15509195 (-)
LOC122350591 lmx1b,lmx1bb,LOC107550585,LOC107723253,LOC107564042,LOC107753135,LOC108434405 coding upstream 287617 15578108 ~ 15648322 (-)
G64355 NA non-coding downstream 1077 15288911 ~ 15289192 (-)
G64354 NA non-coding downstream 4460 15285600 ~ 15285809 (-)
G64352 hmcn2,LOC107570300,LOC107723245,LOC107659581,LOC101073929 non-coding downstream 10473 15279430 ~ 15279796 (-)
G64351 hmcn2,LOC107570300,LOC107723245,LOC107659581 non-coding downstream 30356 15259697 ~ 15259913 (-)
G64348 NA non-coding downstream 67729 15220832 ~ 15222540 (-)
G64357 hmcn2,LOC107659581,LOC107723245,LOC107580106 non-coding upstream 1854 15292345 ~ 15292985 (-)
G64359 hmcn2,LOC107570300,LOC107723245,LOC107659581 non-coding upstream 4859 15295350 ~ 15296221 (-)
G64409 NA non-coding upstream 361145 15651636 ~ 15651859 (-)
LOC122351100 NA non-coding upstream 477177 15767668 ~ 15781887 (-)
G64476 gapvd1,LOC107669250,LOC107753155,LOC107555093,LOC107723237,LOC107550582 non-coding upstream 772388 16062879 ~ 16063753 (-)
G64353 hmcn2,LOC107723245,LOC107659581,LOC107570300 other downstream 6139 15283861 ~ 15284130 (-)
G64228 NA other downstream 508559 14779531 ~ 14781710 (-)
slc20a1a slc20a1a,LOC107724894,LOC107711884,LOC107686402,LOC107667554,LOC107602858,LOC108440301 other downstream 558878 14723712 ~ 14731391 (-)
LOC122350784 zgc:162939,LOC107602843,LOC107674500,LOC107724903 other downstream 835026 14385600 ~ 14455243 (-)
G63933 LOC107556304,LOC107751435,LOC107594508 other downstream 1427019 13809428 ~ 13863250 (-)
mvb12bb mvb12b,LOC107550570,LOC107753158,LOC107723228 other upstream 358735 15649226 ~ 15700896 (-)
LOC122350093 NA other upstream 1117343 16407834 ~ 16409696 (-)
LOC122350945 drd2b,LOC107745132,LOC107705176,LOC107691748,LOC107664308,LOC107600777,LOC107556418,LOC108428674 other upstream 1755976 17046467 ~ 17096795 (-)
LOC122350953 NA other upstream 2029885 17320376 ~ 17401228 (-)
zgc:194007 NA other upstream 2068894 17359385 ~ 17361850 (-)

Expression


Co-expression Network