RNA id: TU171502



Basic Information


Item Value
RNA id TU171502
length 266
lncRNA type inter_gene
GC content 0.54
exon number 1
gene id G116164
representative True

Chromosome Information


Item Value
chromosome id NC_056714.1
NCBI id CM032083.1
chromosome length 28146790
location 24835099 ~ 24835364 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome
species tiger barb
(Puntius tetrazona)

Sequence


GGGTCAAGAGTTCAAAGGCCTCTTTCACATTGTGACCTGTTTTGGCAGAGGCCTCGATGTATGGTGCTCCCAGTTTGCTTGCGAGCTTTTCTGCCTCAGTTCGGTCCACGGCTCGCTCTCCAGCTTTGACCCGGTCACTTTTGTGTCCCACCAGCACAAAGAGCACAGTGTAGGGCTGCACACGTTCACACACCTCTGCGTACCACTGCTGCACGTTTTCGAAAGATTTACGGTTGCCCAGATCGAAGACCAGAAGACCTCCGACT

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU171520 lncRNA downstream 1141 24833536 ~ 24833958 (-) True G116179
TU171515 lncRNA downstream 11689 24821501 ~ 24823410 (-) True G116174
TU171248 lncRNA downstream 361734 24414226 ~ 24473365 (-) False serinc2l
TU171247 lncRNA downstream 361734 24441327 ~ 24473365 (-) False serinc2l
TU171236 lncRNA downstream 466734 24364645 ~ 24368365 (-) False LOC122359997
TU171572 lncRNA upstream 243903 25079267 ~ 25082596 (-) True G116212
TU171618 lncRNA upstream 342088 25177452 ~ 25178607 (-) True G116242
TU171609 lncRNA upstream 376029 25211393 ~ 25558018 (-) True G116237
TU171610 lncRNA upstream 376029 25211393 ~ 25557473 (-) False G116237
XR_006252863.1 lncRNA upstream 829355 25664719 ~ 25702534 (-) False LOC122361130
XM_043260828.1 mRNA downstream 26429 24626594 ~ 24808670 (-) False ptprub
XM_043261009.1 mRNA upstream 722 24836086 ~ 24839787 (-) True taf12
XM_043261006.1 mRNA upstream 4565 24839929 ~ 24846153 (-) True ctps1b
XM_043260492.1 mRNA upstream 57482 24892846 ~ 24906521 (-) False LOC122360137
XM_043260493.1 mRNA upstream 57482 24892846 ~ 24906512 (-) False LOC122360137
XM_043260491.1 mRNA upstream 57482 24892846 ~ 24905755 (-) False LOC122360137
TU171232 other downstream 507126 24326707 ~ 24327973 (-) False phactr4b
TU171098 other downstream 1159801 23669898 ~ 23675298 (-) False mchr2a
XR_006252802.1 other downstream 1225258 23588185 ~ 23609841 (-) False usp45
TU171080 other downstream 1310717 23519808 ~ 23524382 (-) True G115882
TU170599 other downstream 1901132 22932627 ~ 22933967 (-) True G115554
TU171647 other upstream 832455 25667819 ~ 25676410 (-) False LOC122361130
TU172219 other upstream 1544308 26379672 ~ 26384187 (-) True G116604
TU172308 other upstream 1971756 26807120 ~ 26809146 (-) True G116654
TU172257 other upstream 1974953 26810317 ~ 26812909 (-) False G116632
TU172261 other upstream 1974953 26810317 ~ 26812909 (-) False G116632

Expression Profile


TU171502 Expression in all Baseline Samples

Bar chart with 10 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU171502 Expression in each Bioproject

Bar chart with 2 bars.
TU171502 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.