RNA id: XR_006252934.1



Basic Information


Item Value
RNA id XR_006252934.1
length 142
RNA type snoRNA
GC content 0.50
exon number 1
gene id LOC122361375
representative True

Chromosome Information


Item Value
chromosome id NC_056714.1
NCBI id CM032083.1
chromosome length 28146790
location 8647414 ~ 8647555 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome
species tiger barb
(Puntius tetrazona)

Sequence


CTTCCTGTTTTAGTACCACCCACCTGCTTCCTCACAAGGTGTGTGGCTATGCTAACAGGATAGAGGAACTGTCTGTCAAGATCTGAAGGGGCGGATGGCCACACCTCCTCCACCTCTATATGAATTGGCAGTACATCCTGTA

Function


GO: NA

KEGG:

id description
ko04975 Fat digestion and absorption
ko04979 Cholesterol metabolism
ko04977 Vitamin digestion and absorption

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU163638 lncRNA downstream 56780 8589898 ~ 8590634 (-) True G110773
TU163610 lncRNA downstream 95862 8547782 ~ 8551552 (-) True G110753
TU163615 lncRNA downstream 95862 8547782 ~ 8551552 (-) False G110753
TU163331 lncRNA downstream 408238 8237758 ~ 8239176 (-) True G110548
TU163329 lncRNA downstream 411621 8234908 ~ 8235793 (-) True G110546
TU163682 lncRNA upstream 197970 8845525 ~ 8845993 (-) True G110807
TU163727 lncRNA upstream 353232 9000787 ~ 9001428 (-) True G110836
TU163733 lncRNA upstream 356983 9004538 ~ 9005206 (-) True G110842
TU163741 lncRNA upstream 359742 9007297 ~ 9007532 (-) True G110849
TU163744 lncRNA upstream 383580 9031135 ~ 9031449 (-) True G110852
XM_043260323.1 mRNA downstream 11399 8634040 ~ 8636015 (-) False wu:fj39g12
XM_043260322.1 mRNA downstream 11402 8634040 ~ 8636012 (-) False wu:fj39g12
XM_043261749.1 mRNA downstream 17236 8625617 ~ 8630178 (-) True gapdh
XM_043261743.1 mRNA downstream 21895 8617631 ~ 8625519 (-) False opn9
XM_043261744.1 mRNA downstream 21895 8617631 ~ 8625519 (-) True opn9
XM_043261281.1 mRNA upstream 4401 8651956 ~ 8653563 (-) True emg1
XM_043261277.1 mRNA upstream 6278 8653833 ~ 8664175 (-) False kel
XM_043261276.1 mRNA upstream 6278 8653833 ~ 8664174 (-) True kel
XM_043261280.1 mRNA upstream 17011 8664566 ~ 8680965 (-) True zyx
XM_043260964.1 mRNA upstream 84142 8731697 ~ 8758899 (-) False clcn1b
TU163623 other downstream 11192 8633350 ~ 8636222 (-) True wu:fj39g12
TU163343 other downstream 330729 8312265 ~ 8316685 (-) True G110556
TU163340 other downstream 345169 8298789 ~ 8302245 (-) True G110554
TU163327 other downstream 430819 8216029 ~ 8216595 (-) True G110544
TU163302 other downstream 555061 8090651 ~ 8092353 (-) False mkxb
TU163829 other upstream 498375 9145930 ~ 9152183 (-) True G110911
TU163906 other upstream 623416 9270971 ~ 9272605 (-) True G110974
TU164366 other upstream 2099238 10746793 ~ 10748300 (-) False LOC122361037
TU164396 other upstream 2214396 10861951 ~ 10883211 (-) False LOC122360812
TU164397 other upstream 2214396 10861951 ~ 10866428 (-) False LOC122360812

Expression Profile