RNA id: TU225089


Basic Information

Item Value
RNA id TU225089
length 299
lncRNA type inter_gene
GC content 0.51
exon number 3
gene id G152092
representative True

Chromosome Information

Item Value
chromosome id NC_056720.1
NCBI id CM032089.1
chromosome length 18002998
location 12580839 ~ 12620676 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome
species tiger barb
(Puntius tetrazona)

Sequence

ATTCTAAATCTGAGTTTTCAGGCTCAAAGCCGGTGGGCAGACTGATGTCCAGAATCACCATCCTCACCTGCCGTCCCTCCAGAGCCCTTTGGGGTGCAAAGCAGTGAATTATGGGAAACTGAAAGACTGGAGATCGCACCCGTGAAGATCGGGCCACATGTGCCATTTTTGGATTGAATGTCCAGCGTATGTCACTGCGACCAGGAACACTGAGCTCCACCAACAGATTGAGATCTTCAGGAGGAGGCCTTTTCACCAGGTATTCAGACAGAGCCTGTAGCACCACCATAGTGGACTGA

Function

GO:

id name namespace
GO:0030162 regulation of proteolysis biological_process
GO:0051246 regulation of protein metabolic process biological_process
GO:0006508 proteolysis biological_process
GO:0061134 peptidase regulator activity molecular_function
GO:0061135 endopeptidase regulator activity molecular_function
GO:0030414 peptidase inhibitor activity molecular_function
GO:0004857 enzyme inhibitor activity molecular_function
GO:0004866 endopeptidase inhibitor activity molecular_function

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05150 Staphylococcus aureus infection

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU225094 lncRNA upstream 500 12579282 ~ 12580339 (+) False G152095
TU225052 lncRNA upstream 153867 12426756 ~ 12426972 (+) True G152068
TU224994 lncRNA upstream 248994 12306554 ~ 12331845 (+) True G152028
TU224903 lncRNA upstream 313344 12241277 ~ 12267495 (+) False LOC122327127
TU225118 lncRNA downstream 21381 12642057 ~ 12642495 (+) True G152115
TU225126 lncRNA downstream 35273 12655949 ~ 12656429 (+) True G152122
TU225153 lncRNA downstream 126905 12747581 ~ 12747956 (+) True G152140
TU225156 lncRNA downstream 133670 12754346 ~ 12793226 (+) True G152142
TU225195 lncRNA downstream 280594 12901270 ~ 12970358 (+) False G152161
XM_043222265.1 mRNA upstream 38155 12536097 ~ 12542684 (+) False dnaja3b
XM_043222266.1 mRNA upstream 38155 12536097 ~ 12542684 (+) True dnaja3b
XM_043223457.1 mRNA upstream 76862 12485205 ~ 12503977 (+) True vasna
XM_043223942.1 mRNA upstream 101904 12473253 ~ 12478935 (+) True LOC122328225
XM_043223486.1 mRNA upstream 109504 12469118 ~ 12471335 (+) True LOC122327840
XM_043222259.1 mRNA downstream 24505 12645181 ~ 12650074 (+) True LOC122327087
XM_043223532.1 mRNA downstream 37388 12658064 ~ 12658715 (+) True mrps28
XM_043223525.1 mRNA downstream 68248 12688924 ~ 12699036 (+) True LOC122327869
XM_043223524.1 mRNA downstream 92619 12713295 ~ 12722332 (+) True LOC122327868
XM_043223935.1 mRNA downstream 102186 12722862 ~ 12732856 (+) True capn2l
TU225049 other upstream 156917 12409306 ~ 12423922 (+) True G152065
TU225046 other upstream 156917 12414572 ~ 12423922 (+) False G152065
TU225014 other upstream 235089 12345206 ~ 12345750 (+) True G152043
TU225015 other upstream 235089 12345206 ~ 12345750 (+) False G152043
TU225002 other upstream 286122 12293400 ~ 12294717 (+) True G152032
XR_006247603.1 other downstream 486830 13107506 ~ 13112733 (+) True LOC122327162
XR_006247605.1 other downstream 489019 13109695 ~ 13112733 (+) False LOC122327162
XR_006247602.1 other downstream 489025 13109701 ~ 13112733 (+) False LOC122327162
XR_006247604.1 other downstream 489134 13109810 ~ 13112733 (+) False LOC122327162
XR_006247606.1 other downstream 489139 13109815 ~ 13112733 (+) False LOC122327162

Expression Profile