RNA id: TCONS_00010803


Basic Information

Item Value
RNA id TCONS_00010803
length 793
lncRNA type inter_gene
GC content 0.31
exon number 3
gene id XLOC_005243
representative False

Chromosome Information

Item Value
chromosome id NC_007123.7
NCBI id CM002896.2
chromosome length 49182954
location 15117887 ~ 15120113 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

cagatgcagaaacttttgacatatgaattcatcttgactaaggaactcttcacagcactgcagctaaacagtcacaacctcacagagctgcacaactgccccactcagatcagtgttgaagctggaacctcatcttgtgtacagcaaaggcagagctgaaaattcactgtttgtcttgtattgtgtgtggcaaaacctggaataacacatgggagccctccaggaattgctgacactttacgcccaagtctcctcatgctaaccggattgcaatatgacagtctagtcagcataaacacctggactcaccaagcacactttggttctcagtgttttgtaaaaatagtttttgctattcttcagtaaatacttgaatatgttttgaacttattctacttttgatgtttaagttcagaaagttgttattataaacataatttgcatttgtcatgaacttgacttcttgttgttgtgaaagctgtttattatgatggcatttccaaaggcatcatttgaaaagattttttgcagtgcagttttacttgagcttgacataccagatgtatgacatgaataaatatcacaaaataaatataataataataatacaaaatatacatttccttcaattataattgtttttaatcatttatatatgtatggtaatatattattgcattaaaaacttataaaatatatatttttggttaaaatatatatttttgcatttttgtgtgatttttattatttatttttatttgtggcattataaataaattataaatgtttcatt

Function

GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0009058 biosynthetic process biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0060429 epithelium development biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:1903224 regulation of endodermal cell differentiation biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:0035987 endodermal cell differentiation biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0000785 chromatin cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00011106 lncRNA downstream 277328 14839787 ~ 14840559 (-) True XLOC_005240
TCONS_00010086 lncRNA downstream 973728 14138286 ~ 14144159 (-) True XLOC_005237
TCONS_00010085 lncRNA downstream 1067398 14036432 ~ 14050489 (-) True XLOC_005236
TCONS_00010071 lncRNA downstream 1780934 13333532 ~ 13336953 (-) True XLOC_005228
TCONS_00011105 lncRNA downstream 2011664 13102866 ~ 13106223 (-) True XLOC_005224
TCONS_00011108 lncRNA upstream 5296 15125409 ~ 15126049 (-) True XLOC_005244
TCONS_00011109 lncRNA upstream 122454 15242567 ~ 15244000 (-) True XLOC_005246
TCONS_00011110 lncRNA upstream 325461 15445574 ~ 15450258 (-) True XLOC_005247
TCONS_00011111 lncRNA upstream 737619 15857732 ~ 15859869 (-) True XLOC_005250
TCONS_00010106 lncRNA upstream 1326115 16446228 ~ 16447272 (-) False XLOC_005254
TCONS_00010092 mRNA downstream 115268 14965600 ~ 15002619 (-) True XLOC_005242
TCONS_00010091 mRNA downstream 115324 14965587 ~ 15002563 (-) False XLOC_005242
TCONS_00010090 mRNA downstream 194932 14920088 ~ 14922955 (-) True XLOC_005241
TCONS_00010089 mRNA downstream 566810 14545475 ~ 14551077 (-) True XLOC_005239
TCONS_00010087 mRNA downstream 906594 14166036 ~ 14211293 (-) False XLOC_005238
TCONS_00010093 mRNA upstream 77744 15197857 ~ 15205087 (-) True XLOC_005245
TCONS_00010094 mRNA upstream 445231 15565344 ~ 15567104 (-) True XLOC_005248
TCONS_00010095 mRNA upstream 448648 15568761 ~ 15584479 (-) False XLOC_005249
TCONS_00010096 mRNA upstream 448650 15568763 ~ 15620090 (-) False XLOC_005249
TCONS_00010098 mRNA upstream 942447 16062560 ~ 16084835 (-) True XLOC_005251
TCONS_00010077 other downstream 1467597 13603739 ~ 13650290 (-) True XLOC_005231
TCONS_00010060 other downstream 2782556 12335216 ~ 12335331 (-) True XLOC_005222
TCONS_00010022 other downstream 5446750 9669927 ~ 9671137 (-) True XLOC_005196
TCONS_00010021 other downstream 5469542 9648228 ~ 9648345 (-) True XLOC_005195
TCONS_00010016 other downstream 5600934 9510871 ~ 9516953 (-) True XLOC_005191
TCONS_00010097 other upstream 461207 15581320 ~ 15584532 (-) True XLOC_005249
TCONS_00010103 other upstream 1288195 16408308 ~ 16416757 (-) False XLOC_005253
TCONS_00010104 other upstream 1295697 16415810 ~ 16434838 (-) False XLOC_005253
TCONS_00010105 other upstream 1311703 16431816 ~ 16434835 (-) True XLOC_005253
TCONS_00010111 other upstream 1373239 16493352 ~ 16493468 (-) True XLOC_005255

Expression Profile

//