RNA id: TU44458


Basic Information

Item Value
RNA id TU44458
length 222
lncRNA type inter_gene
GC content 0.55
exon number 1
gene id G30005
representative True

Chromosome Information

Item Value
chromosome id NC_056702.1
NCBI id CM032071.1
chromosome length 29200999
location 20785309 ~ 20785530 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome
species tiger barb
(Puntius tetrazona)

Sequence

CGAGACGCCACTTCTCCCACGCGTCCATCGAATACCCGGCCGCCATCGTCCCGGCAGGACAATCGGGTTCCCCCGAACCCACGCTTCTCTTCGAGAAGATGGTGTCAATTGCGTTGAGAGACCAGTTGATCAAATCCATGTTTTCAGCTGGAGAGCAGGGCAGAGAGAGTCTCTCAAGTGGAGAAAAGTAGACACAAGACGAGACTAAGAAGCACAAGCAGG

Function

GO:

id name namespace
GO:0043254 regulation of protein-containing complex assembly biological_process
GO:0044085 cellular component biogenesis biological_process
GO:0044087 regulation of cellular component biogenesis biological_process
GO:0044089 positive regulation of cellular component biogenesis biological_process
GO:0051128 regulation of cellular component organization biological_process
GO:0051130 positive regulation of cellular component organization biological_process
GO:0022607 cellular component assembly biological_process
GO:0010638 positive regulation of organelle organization biological_process
GO:0065003 protein-containing complex assembly biological_process
GO:0065008 regulation of biological quality biological_process
GO:0008154 actin polymerization or depolymerization biological_process
GO:1902903 regulation of supramolecular fiber organization biological_process
GO:1902905 positive regulation of supramolecular fiber organization biological_process
GO:0090066 regulation of anatomical structure size biological_process
GO:0051493 regulation of cytoskeleton organization biological_process
GO:0051495 positive regulation of cytoskeleton organization biological_process
GO:0006996 organelle organization biological_process
GO:0031334 positive regulation of protein-containing complex assembly biological_process
GO:0032956 regulation of actin cytoskeleton organization biological_process
GO:0007010 cytoskeleton organization biological_process
GO:0043933 protein-containing complex subunit organization biological_process
GO:0007015 actin filament organization biological_process
GO:0032970 regulation of actin filament-based process biological_process
GO:0051258 protein polymerization biological_process
GO:0097435 supramolecular fiber organization biological_process
GO:0034314 Arp2/3 complex-mediated actin nucleation biological_process
GO:0030832 regulation of actin filament length biological_process
GO:0030833 regulation of actin filament polymerization biological_process
GO:0030838 positive regulation of actin filament polymerization biological_process
GO:0030029 actin filament-based process biological_process
GO:0033043 regulation of organelle organization biological_process
GO:0034622 cellular protein-containing complex assembly biological_process
GO:0030036 actin cytoskeleton organization biological_process
GO:0030041 actin filament polymerization biological_process
GO:0045010 actin nucleation biological_process
GO:0110053 regulation of actin filament organization biological_process
GO:0008064 regulation of actin polymerization or depolymerization biological_process
GO:0032535 regulation of cellular component size biological_process
GO:0032271 regulation of protein polymerization biological_process
GO:0032273 positive regulation of protein polymerization biological_process

KEGG:

id description
ko05130 Pathogenic Escherichia coli infection
ko05100 Bacterial invasion of epithelial cells

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU44383 lncRNA upstream 139774 20645257 ~ 20645535 (+) True G29947
TU44381 lncRNA upstream 153980 20630820 ~ 20631329 (+) True G29945
TU44363 lncRNA upstream 287441 20497097 ~ 20497868 (+) True G29927
XR_006250699.1 lncRNA upstream 322967 20459370 ~ 20462342 (+) True LOC122343178
XR_006250698.1 lncRNA upstream 325115 20459370 ~ 20460194 (+) False LOC122343178
TU44456 lncRNA downstream 94919 20880449 ~ 20882908 (+) True G30003
TU44493 lncRNA downstream 124624 20910154 ~ 20975778 (+) True G30024
TU44494 lncRNA downstream 127028 20912558 ~ 20934912 (+) True G30025
XR_006250691.1 lncRNA downstream 185980 20971510 ~ 20972249 (+) True LOC122343171
TU44529 lncRNA downstream 332131 21117661 ~ 21118522 (+) True G30056
XM_043237203.1 mRNA upstream 107400 20655215 ~ 20677909 (+) True LOC122342964
XM_043237404.1 mRNA upstream 140517 20640142 ~ 20644792 (+) False LOC122343085
XM_043237403.1 mRNA upstream 140517 20641611 ~ 20644792 (+) True LOC122343085
XM_043236075.1 mRNA upstream 146698 20633884 ~ 20638611 (+) True LOC122342277
XM_043237273.1 mRNA upstream 226295 20543132 ~ 20559014 (+) True LOC122343005
XM_043237174.1 mRNA downstream 4645 20790175 ~ 20800541 (+) True LOC122342951
XM_043237448.1 mRNA downstream 116689 20902219 ~ 20906726 (+) True LOC122343111
XM_043237467.1 mRNA downstream 132020 20917550 ~ 20918689 (+) True LOC122343116
XM_043236078.1 mRNA downstream 135905 20921435 ~ 20929163 (+) True LOC122342280
XM_043236079.1 mRNA downstream 232622 21018152 ~ 21020872 (+) True LOC122342283
TU44410 other upstream 78463 20696672 ~ 20706846 (+) True G29961
TU44357 other upstream 416493 20367675 ~ 20368816 (+) True G29921
XR_006250910.1 other upstream 537080 20248111 ~ 20248229 (+) True LOC122343930
unassigned_transcript_379 other upstream 678182 20107054 ~ 20107127 (+) True trnam-cau_25
unassigned_transcript_377 other upstream 678954 20106282 ~ 20106355 (+) True trnam-cau_24
TU44534 other downstream 333032 21118562 ~ 21142831 (+) True G30058
TU44553 other downstream 383719 21169249 ~ 21170595 (+) False LOC122342286
TU44625 other downstream 583113 21368643 ~ 21761178 (+) False LOC122342301
TU44637 other downstream 602663 21388193 ~ 21630120 (+) True G30119
TU44630 other downstream 854010 21639540 ~ 21641756 (+) True G30115

Expression Profile