RNA id: TCONS_00010196


Basic Information

Item Value
RNA id TCONS_00010196
length 478
RNA type mRNA
GC content 0.50
exon number 3
gene id XLOC_005310
representative True

Chromosome Information

Item Value
chromosome id NC_007123.7
NCBI id CM002896.2
chromosome length 49182954
location 19099264 ~ 19103490 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GAACTTCACACCAATGGCTGATTCAGAAAGCACGTCAACGTCTGATGGAAAGCTGCACTGCCCACACACACCTCTCTCGCTTTCATTACCTTTCCTGAGGGAGGGCAGTGGTCTTCTGGAGAGGAAACCTCCTCAGACGGGGGAACCTCCGAGTCCACTGCCAACCAAACGCACACGCACATATTCAGCATCGGTGAGAGCCAAATCTGGACCTGTTTACAAGGGCATTTGCAAGAACTTTTCAAGGTCTCAAGGTCATGGATTCATTCGGCCCTCCCATGGAGGAGAAGACATATTTGTCCACATCTCAGATATTGAGGGTGAATATGTCCCCATGGAGGGGGATGAGGTGACCTACAAAGTGTGTCCTGTTCCTCCCAAAAACATAAAGTTTCAAGCAGTCGAAGTGGTCATCACCAACCTTTCTTCCGGAAGGAAACACGAGACCTGGTCTGGGCAAGTGATCAGCTCGTAGCTC

Function

GO:

id name namespace
GO:0043488 regulation of mRNA stability biological_process
GO:0005737 cytoplasm cellular_component
GO:0003676 nucleic acid binding molecular_function
GO:0003730 mRNA 3'-UTR binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040718-442 Predicted to enable mRNA 3'-UTR binding activity. Predicted to be involved in regulation of mRNA stability. Predicted to be active in cytoplasm. Is expressed in nervous system; neural tube; and trigeminal placode. Orthologous to human CSDC2 (cold shock domain containing C2).

Ensembl:

ensembl_id ENSDART00000180364

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00011119 lncRNA downstream 645433 18453207 ~ 18454407 (-) True XLOC_005298
TCONS_00010174 lncRNA downstream 685324 18413442 ~ 18414516 (-) True XLOC_005297
TCONS_00011118 lncRNA downstream 688087 18410611 ~ 18411753 (-) False XLOC_005297
TCONS_00010172 lncRNA downstream 688087 18410611 ~ 18411753 (-) False XLOC_005297
TCONS_00010171 lncRNA downstream 688216 18410611 ~ 18411624 (-) False XLOC_005297
TCONS_00010204 lncRNA upstream 175654 19278390 ~ 19282009 (-) True XLOC_005315
TCONS_00011120 lncRNA upstream 954235 20056971 ~ 20065827 (-) False XLOC_005318
TCONS_00011121 lncRNA upstream 1212259 20314995 ~ 20334709 (-) True XLOC_005321
TCONS_00010219 lncRNA upstream 1303850 20406586 ~ 20409746 (-) True XLOC_005326
TCONS_00010222 lncRNA upstream 1477830 20580566 ~ 20584439 (-) False XLOC_005327
TCONS_00010194 mRNA downstream 8626 19065679 ~ 19091214 (-) True XLOC_005309
TCONS_00010192 mRNA downstream 71772 19007926 ~ 19028068 (-) False XLOC_005308
TCONS_00010193 mRNA downstream 71794 19024230 ~ 19028046 (-) True XLOC_005308
TCONS_00010191 mRNA downstream 92006 18989486 ~ 19007834 (-) True XLOC_005307
TCONS_00010190 mRNA downstream 138551 18929062 ~ 18961289 (-) True XLOC_005306
TCONS_00010197 mRNA upstream 3835 19106571 ~ 19119176 (-) True XLOC_005311
TCONS_00010198 mRNA upstream 42097 19144833 ~ 19151708 (-) False XLOC_005312
TCONS_00010199 mRNA upstream 43109 19145845 ~ 19153177 (-) True XLOC_005312
TCONS_00010200 mRNA upstream 56096 19158832 ~ 19185865 (-) True XLOC_005313
TCONS_00010201 mRNA upstream 137874 19240610 ~ 19250854 (-) True XLOC_005314
TCONS_00010183 other downstream 361311 18738413 ~ 18738529 (-) True XLOC_005303
TCONS_00010161 other downstream 1392939 17706792 ~ 17706901 (-) True XLOC_005289
TCONS_00010135 other downstream 2101398 16997206 ~ 16998442 (-) True XLOC_005275
TCONS_00010131 other downstream 2198081 16901645 ~ 16901759 (-) True XLOC_005269
TCONS_00010127 other downstream 2353293 16743282 ~ 16746547 (-) True XLOC_005265
TCONS_00010211 other upstream 1086433 20189169 ~ 20189286 (-) True XLOC_005319
TCONS_00010220 other upstream 1472904 20575640 ~ 20584439 (-) False XLOC_005327
TCONS_00010232 other upstream 2467047 21569783 ~ 21569899 (-) True XLOC_005332
TCONS_00010235 other upstream 2570213 21672949 ~ 21680620 (-) False XLOC_005333
TCONS_00010242 other upstream 3128410 22231146 ~ 22238004 (-) True XLOC_005336

Expression Profile

//