RNA id: TU65036



Basic Information


Item Value
RNA id TU65036
length 433
lncRNA type inter_gene
GC content 0.47
exon number 1
gene id G43906
representative True

Chromosome Information


Item Value
chromosome id NC_056704.1
NCBI id CM032073.1
chromosome length 27473687
location 9275640 ~ 9276072 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome
species tiger barb
(Puntius tetrazona)

Sequence


ATGACAGCTACTGCAGCATGCATGGCCAATGCCTCACAGCTGTTCTGCTTATTTAGCATGTGAGATGGGACGTCCCGTAGCAGTGATATAGTCAATTCTCTTCCATCTGGGCAGCCCAATGTGTACGGCAGTAACAACATATGCAGTCGCTGTAGATGTTAACCTTCCGTCCCTCTGCGTAGTGCAGGGCCTCTATCATTGCCAACAATTCAGCTCTCTGAGCAGACTGCTTTCCTGTCAACCTTCCTGCCTTCACTGTGCTAAACCTACCATCAACTTCTTGGACTACTACAAATCCAGACTTCAGCTCTCTTCATCCCTGAAGCAACAACCATCAGTAAACAATGTCATAACATCTTCATCTAATAGTGGCGTCACAGACAGGTCAGCCCTAGCTTTTGTCTAAAACTTTGGCCAGACGTCTTTGTCTCAG

Function


GO:

id name namespace
GO:0005102 signaling receptor binding molecular_function
GO:0005126 cytokine receptor binding molecular_function
GO:0005164 tumor necrosis factor receptor binding molecular_function
GO:0032813 tumor necrosis factor receptor superfamily binding molecular_function

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU65024 lncRNA downstream 11066 9264327 ~ 9264574 (-) True G43894
TU65022 lncRNA downstream 13031 9262403 ~ 9262609 (-) True G43892
TU65014 lncRNA downstream 19631 9255726 ~ 9256009 (-) True G43884
TU65008 lncRNA downstream 22572 9251986 ~ 9253068 (-) True G43880
TU65011 lncRNA downstream 23961 9250699 ~ 9251679 (-) True G43881
TU65048 lncRNA upstream 4859 9280931 ~ 9281402 (-) True G43915
TU65049 lncRNA upstream 5443 9281515 ~ 9282468 (-) True G43916
TU65157 lncRNA upstream 109037 9385109 ~ 9729660 (-) True G43991
TU65182 lncRNA upstream 303624 9579696 ~ 9915583 (-) True G44010
TU65205 lncRNA upstream 616159 9892231 ~ 9898950 (-) True G44031
XM_043241779.1 mRNA downstream 280007 8971674 ~ 8995633 (-) True srp68
XM_043241665.1 mRNA downstream 308260 8955256 ~ 8967380 (-) True evpla
XM_043241777.1 mRNA downstream 324467 8933083 ~ 8951173 (-) True acox1
XM_043242589.1 mRNA upstream 7331 9283403 ~ 9299043 (-) False nol11
XM_043242588.1 mRNA upstream 7331 9283403 ~ 9299043 (-) True nol11
XM_043241579.1 mRNA upstream 32514 9308586 ~ 9352668 (-) False si:dkey-237i9.1
XM_043241581.1 mRNA upstream 32514 9308586 ~ 9352668 (-) True si:dkey-237i9.1
XM_043241580.1 mRNA upstream 32514 9308586 ~ 9352665 (-) False si:dkey-237i9.1
TU65030 other downstream 3335 9271418 ~ 9272305 (-) True G43900
TU65029 other downstream 4718 9269188 ~ 9270922 (-) True G43899
TU65026 other downstream 8316 9266002 ~ 9267324 (-) True G43896
TU65020 other downstream 14395 9260616 ~ 9261245 (-) True G43890
TU64905 other downstream 561782 8712021 ~ 8713858 (-) False G43801
TU65247 other upstream 749506 10025578 ~ 10027635 (-) False c6h17orf67
TU65385 other upstream 865539 10141611 ~ 10145147 (-) False cd7al
TU65678 other upstream 1433973 10710045 ~ 10716741 (-) True G44358
XR_006251151.1 other upstream 1778963 11055035 ~ 11069458 (-) False brdt
XR_006251152.1 other upstream 1778963 11055035 ~ 11069457 (-) False brdt

Expression Profile


TU65036 Expression in all Baseline Samples

Bar chart with 10 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

TU65036 Expression in each Bioproject

Bar chart with 2 bars.
TU65036 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.