RNA id: TU55119



Basic Information


Item Value
RNA id TU55119
length 320
lncRNA type inter_gene
GC content 0.42
exon number 1
gene id G40949
representative True

Chromosome Information


Item Value
chromosome id NC_035901.1
NCBI id CM008304.1
chromosome length 40584741
location 8164952 ~ 8165271 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome
species mexican tetra
(Astyanax mexicanus)

Sequence


ATCATAGGACATGGGACTAGTATCATAGGACATGGGACTAGTATCATAGGACATGGGACTAGTATCATAGGACATGGAACTAGTATCATAGGACATGGGACTAGTATCATAGGACATGGGACTAGTATCATAGGACATGGGACTAGTATCATAGGACATGGGACTAGTATCATAGGACATGGGACTAGTATCATAGGACATGGGACTAGTATCATTGGGCTAGTATCAAGGGACTAGTATCATAGGACATGGGACTAGTATCATGGGACTAGTATCATAGGACATGGGACTAGTATCATAGGACATGGGACTAGTATCAT

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU55117 lncRNA upstream 885 8163711 ~ 8164067 (+) True G40947
TU55082 lncRNA upstream 196529 7968116 ~ 7968423 (+) True G40916
TU55076 lncRNA upstream 375346 7788450 ~ 7789606 (+) True G40910
TU55068 lncRNA upstream 452369 7712334 ~ 7712583 (+) True G40902
TU54998 lncRNA upstream 652270 7509178 ~ 7512682 (+) True G40842
TU55120 lncRNA downstream 120 8165391 ~ 8165661 (+) True G40950
TU55122 lncRNA downstream 2508 8167779 ~ 8169537 (+) True G40952
XR_002649927.1 lncRNA downstream 244191 8409462 ~ 8454415 (+) True LOC111192502
TU55147 lncRNA downstream 244379 8409650 ~ 8454348 (+) False LOC111192502
TU55167 lncRNA downstream 334492 8499763 ~ 8500064 (+) True G40987
XM_007252576.3 mRNA upstream 1994 8102275 ~ 8162958 (+) True xxylt1
XM_007252577.2 mRNA upstream 1151165 6877772 ~ 7013787 (+) True pcdh17
XM_015606694.2 mRNA upstream 1151165 6877772 ~ 7013787 (+) False pcdh17
XM_022669530.1 mRNA upstream 2328865 5814515 ~ 5836087 (+) True lims1
XM_022669528.1 mRNA upstream 2331077 5814514 ~ 5833875 (+) False lims1
XM_022669536.1 mRNA downstream 196566 8361837 ~ 8377825 (+) True lsg1
XM_022670142.1 mRNA downstream 216985 8382256 ~ 8400857 (+) True tmem44
XM_022670147.1 mRNA downstream 294244 8459515 ~ 8498939 (+) True atp13a3
XM_022669537.1 mRNA downstream 346833 8512104 ~ 8523308 (+) True LOC103028988
XM_022669538.1 mRNA downstream 386699 8551970 ~ 8636478 (+) True col6a1
XR_001518717.2 other upstream 338038 7826523 ~ 7826914 (+) True LOC107197696
TU54910 other upstream 1631278 6533365 ~ 6533674 (+) True G40756
TU54660 other upstream 2854145 5308546 ~ 5310807 (+) False snrpa1
TU54378 other upstream 4029367 4134510 ~ 4135585 (+) True G40318
TU53995 other upstream 5426735 2735596 ~ 2738217 (+) False LOC103029230
TU55733 other downstream 1830482 9995753 ~ 10005398 (+) False LOC103037553
trnar-ucg_1 other downstream 2127066 10292337 ~ 10292409 (+) True trnar-ucg_1
trnam-cau_21 other downstream 2589938 10755209 ~ 10755281 (+) True trnam-cau_21
TU56242 other downstream 3405955 11571226 ~ 11580329 (+) True G41828
TU56269 other downstream 3589072 11754343 ~ 11757209 (+) False tmem221

Expression Profile


TU55119 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU55119 Expression in each Bioproject

Bar chart with 6 bars.
TU55119 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.