RNA id: TU104126


Basic Information

Item Value
RNA id TU104126
length 298
lncRNA type read_through
GC content 0.46
exon number 2
gene id G77214
representative True

Chromosome Information

Item Value
chromosome id NC_035905.1
NCBI id CM008308.1
chromosome length 42966623
location 965814 ~ 1050942 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome
species mexican tetra
(Astyanax mexicanus)

Sequence

tcccacactgtgtctcttggtgcagctgtgcagctatagctgcaaaaaaacagcaaaagcaaaccacctggcctttttcacctcctggacctgagcatgaacttcagagcagctgtttactctccactccagcaaaagatgctccacatatgagctgctaactcatccatttccctttataaagctacgagtctctcctctctctaatatgagggttttgttgttggtgaagaaggaggtgtttatacaggtatcaatgtgcagcatgtgagacgcttcaggaacagattctgtgttc

Function

GO:

id name namespace
GO:0009250 glucan biosynthetic process biological_process
GO:0006073 cellular glucan metabolic process biological_process
GO:0033692 cellular polysaccharide biosynthetic process biological_process
GO:0006091 generation of precursor metabolites and energy biological_process
GO:0006112 energy reserve metabolic process biological_process
GO:0044262 cellular carbohydrate metabolic process biological_process
GO:0044264 cellular polysaccharide metabolic process biological_process
GO:0015980 energy derivation by oxidation of organic compounds biological_process
GO:0005975 carbohydrate metabolic process biological_process
GO:0005976 polysaccharide metabolic process biological_process
GO:0005977 glycogen metabolic process biological_process
GO:0005978 glycogen biosynthetic process biological_process
GO:0034637 cellular carbohydrate biosynthetic process biological_process
GO:0044042 glucan metabolic process biological_process
GO:0000271 polysaccharide biosynthetic process biological_process
GO:0016051 carbohydrate biosynthetic process biological_process

KEGG:

id description
ko00010 Glycolysis / Gluconeogenesis

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU104104 lncRNA upstream 28581 936248 ~ 937233 (+) True G77198
TU104103 lncRNA upstream 30136 918337 ~ 935678 (+) True LOC103037215
TU104116 lncRNA upstream 52154 913108 ~ 913660 (+) True G77207
TU104112 lncRNA upstream 57534 907806 ~ 908280 (+) True G77203
TU104164 lncRNA downstream 187402 1238344 ~ 1238806 (+) True G77245
TU104180 lncRNA downstream 214895 1265837 ~ 1266074 (+) True G77259
TU104327 lncRNA downstream 293154 1344096 ~ 1345264 (+) True G77375
TU104329 lncRNA downstream 294401 1345343 ~ 1346504 (+) False G77376
TU104328 lncRNA downstream 294532 1345474 ~ 1349654 (+) True G77376
XM_022672556.1 mRNA upstream 31831 883297 ~ 933983 (+) False LOC103037215
XM_007255088.3 mRNA upstream 127661 834977 ~ 838153 (+) True eef1akmt2
XM_022672552.1 mRNA upstream 151124 776124 ~ 814690 (+) True arhgap5
XM_022672559.1 mRNA downstream 136178 1187120 ~ 1203142 (+) True LOC103043042
XM_022672563.1 mRNA downstream 253125 1304067 ~ 1318118 (+) True LOC107197738
XM_022672564.1 mRNA downstream 268477 1319419 ~ 1329088 (+) True gcfc2
XM_022672570.1 mRNA downstream 419073 1470015 ~ 1479658 (+) True LOC103037734
XM_022672569.1 mRNA downstream 419077 1470019 ~ 1479658 (+) False LOC103037734
TU104033 other upstream 333442 631714 ~ 632372 (+) True G77154
TU103901 other upstream 445224 519633 ~ 520590 (+) True G77059
TU103782 other upstream 832654 106902 ~ 133160 (+) False ldah
TU103781 other upstream 832654 126248 ~ 133160 (+) False ldah
TU103780 other upstream 850451 84729 ~ 115363 (+) False ldah
TU104376 other downstream 433728 1484670 ~ 1485050 (+) True G77410
TU104477 other downstream 642414 1693356 ~ 1696981 (+) True G77471
TU104827 other downstream 1849192 2900134 ~ 2978094 (+) True G77722
TU104828 other downstream 1849192 2900134 ~ 2978094 (+) False G77722
trnav-aac_2 other downstream 2365226 3416168 ~ 3416240 (+) True trnav-aac_2

Expression Profile