RNA id: TU104817


Basic Information

Item Value
RNA id TU104817
length 234
lncRNA type sense_over
GC content 0.35
exon number 2
gene id G77715
representative True

Chromosome Information

Item Value
chromosome id NC_035905.1
NCBI id CM008308.1
chromosome length 42966623
location 2809559 ~ 2828232 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome
species mexican tetra
(Astyanax mexicanus)

Sequence

cagaaatcaatatttggtggaataatcctggtttttaatcacagtttttaatcatgcatcttggcatcatgttctcctccaccagtcttacacactgcttttggataactttatgctgctttactcctggtgcaaaaattcaagcagttcagtttggtggtttgatggtttgtgatcatccatctttctcttgattatattccagaggttttcaatttggtaaaatcaaagaaa

Function

GO:

id name namespace
GO:0006508 proteolysis biological_process
GO:0004175 endopeptidase activity molecular_function
GO:0004252 serine-type endopeptidase activity molecular_function
GO:0008236 serine-type peptidase activity molecular_function
GO:0017171 serine hydrolase activity molecular_function

KEGG:

id description
ko04972 Pancreatic secretion
ko04974 Protein digestion and absorption
ko04975 Fat digestion and absorption

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU104813 lncRNA upstream 65948 2719123 ~ 2743611 (+) True G77712
TU104812 lncRNA upstream 96289 2702199 ~ 2713270 (+) True G77711
TU104625 lncRNA upstream 332556 2451427 ~ 2477003 (+) True G77575
TU104605 lncRNA upstream 345238 2461787 ~ 2464321 (+) False LOC103031026
TU104602 lncRNA upstream 357114 2448192 ~ 2452445 (+) True G77566
TU104819 lncRNA downstream 4336 2832568 ~ 2869809 (+) False G77716
TU104818 lncRNA downstream 38929 2867161 ~ 2869809 (+) True G77716
TU104820 lncRNA downstream 41625 2869857 ~ 2870831 (+) True G77717
TU104822 lncRNA downstream 51658 2879890 ~ 2883024 (+) True G77719
TU104824 lncRNA downstream 56460 2884692 ~ 2892308 (+) False G77720
XM_022672489.1 mRNA upstream 334768 2471398 ~ 2474791 (+) True LOC103026149
XM_007257927.3 mRNA upstream 340997 2465310 ~ 2468562 (+) True LOC103026471
XM_007257942.3 mRNA upstream 345307 2458445 ~ 2464252 (+) True LOC103031026
XM_022672592.1 mRNA upstream 496897 2247051 ~ 2312662 (+) False fsip1
XM_022672596.1 mRNA downstream 80377 2908609 ~ 2957430 (+) True eif2ak4
XM_022672602.1 mRNA downstream 433559 3261791 ~ 3296653 (+) True tecpr2
XM_022672603.1 mRNA downstream 481586 3309818 ~ 3324750 (+) True rcor1
XM_022672604.1 mRNA downstream 503699 3331931 ~ 3359744 (+) True traf3
XM_022672606.1 mRNA downstream 537510 3365742 ~ 3393158 (+) True LOC103028495
TU104477 other upstream 1112578 1693356 ~ 1696981 (+) True G77471
TU104376 other upstream 1324509 1484670 ~ 1485050 (+) True G77410
TU104123 other upstream 1800717 1005129 ~ 1008842 (+) True G77212
TU104033 other upstream 2177187 631714 ~ 632372 (+) True G77154
TU103901 other upstream 2288969 519633 ~ 520590 (+) True G77059
TU104827 other downstream 71902 2900134 ~ 2978094 (+) True G77722
TU104828 other downstream 71902 2900134 ~ 2978094 (+) False G77722
trnav-aac_2 other downstream 587936 3416168 ~ 3416240 (+) True trnav-aac_2
trnav-aac_3 other downstream 588607 3416839 ~ 3416911 (+) True trnav-aac_3
trnav-cac_1 other downstream 591695 3419927 ~ 3419999 (+) True trnav-cac_1

Expression Profile