RNA id: TU299320



Basic Information


Item Value
RNA id TU299320
length 932
lncRNA type inter_gene
GC content 0.50
exon number 7
gene id G220640
representative True

Chromosome Information


Item Value
chromosome id NC_035921.1
NCBI id CM008324.1
chromosome length 46505145
location 31172175 ~ 31175036 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome
species mexican tetra
(Astyanax mexicanus)

Sequence


gtgttgctatggtatccagggtggttgctaaggtgttgctaggtggttgctaggtggttgctaaggtgttgctatgcggttgctaaggtgttgctatggtatctggggtggttgctaaggtgttgctaggtggttgctaaggtgttgctaggtggttgctaaggtgttgctatggtatctggggtggttgctaaggtgttgctaggcggttgctaaggtgttgctaggtggttgctaaggtgttgctatggtatctgtggtggttgctaaggtgttgctatggtatccgggtggttgctaggtggttgctaacgtgttgctaggcggttgctaaggtgttgctatggtatccagggtggttgctaaggtgttgctaggcggttgctaaggtattgctatggtatccggggtggttgctaaggtgctgctaggtggttgcaaggtggttgctaaggtgttgctaggcggttgctaaggtgttgctatggtatccggggtggttgctaggtggttgctaaggtgttgctaggtggttgctaaggtgttgctatggtatctggggtggttgctaaggtgttgctaggtggttgctaaggtgttgctagatggttgctaaggtgttgctatggtatccagggtggttgccaaggtgttgctaggtggttgctagggtgttgctaggcggttgctaaggtgttgctatggtatccagggtggttgctaaggtgttgctaggtggttgctaggcggttgctaaggtgttgctatggtatccgaggtggttgctaaatggttactaggcagttgctaacgtattccacatggttgctaagtggttgctaggcacttgctaatgttttccaggtggttgctaaggtgttgctaactggttgctaggcagttgctaacgtattccacatggttgctaagtg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU299306 lncRNA upstream 11334 31155130 ~ 31161593 (+) True G220629
TU299272 lncRNA upstream 272512 30896128 ~ 30900415 (+) True G220605
XR_002651975.1 lncRNA upstream 311344 30851722 ~ 30861583 (+) True LOC111196026
TU299040 lncRNA upstream 984920 30186222 ~ 30188007 (+) True G220407
TU299021 lncRNA upstream 1013135 30106425 ~ 30159792 (+) False G220392
TU299299 lncRNA downstream 348 31175384 ~ 31176680 (+) True G220624
TU299413 lncRNA downstream 131733 31306769 ~ 31308879 (+) True G220692
TU299416 lncRNA downstream 149808 31324844 ~ 31330182 (+) True G220694
TU299425 lncRNA downstream 159219 31334255 ~ 31334543 (+) True G220700
TU299428 lncRNA downstream 164855 31339891 ~ 31342707 (+) True G220702
XM_022684986.1 mRNA upstream 174429 30977403 ~ 30998498 (+) False lrrc73
XM_007247382.3 mRNA upstream 174429 30980808 ~ 30998498 (+) True lrrc73
XM_007247383.3 mRNA upstream 202277 30961520 ~ 30970650 (+) True yipf3
XM_022684985.1 mRNA upstream 202277 30961520 ~ 30970650 (+) False yipf3
XM_022684984.1 mRNA upstream 230141 30924412 ~ 30942786 (+) True LOC103025585
XM_015605347.2 mRNA downstream 69124 31244160 ~ 31282824 (+) False dlk2
XM_015605346.2 mRNA downstream 78677 31253713 ~ 31282824 (+) True dlk2
XM_015605348.2 mRNA downstream 78818 31253854 ~ 31282824 (+) False dlk2
XM_007247376.3 mRNA downstream 119145 31294181 ~ 31298256 (+) True mea1
XM_007247342.3 mRNA downstream 255244 31430280 ~ 31436529 (+) True mrps6
TU299278 other upstream 220986 30949012 ~ 30951941 (+) True G220610
TU298921 other upstream 1379431 29787939 ~ 29793496 (+) True G220336
trnak-cuu_12 other downstream 217698 31392734 ~ 31392806 (+) True trnak-cuu_12
trnaa-agc_18 other downstream 228671 31403707 ~ 31403779 (+) True trnaa-agc_18
trnag-gcc_3 other downstream 239864 31414900 ~ 31414970 (+) True trnag-gcc_3
trnag-gcc_5 other downstream 247716 31422752 ~ 31422822 (+) True trnag-gcc_5
trnak-cuu_13 other downstream 253204 31428240 ~ 31428312 (+) True trnak-cuu_13

Expression Profile


TU299320 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

TU299320 Expression in each Bioproject

Bar chart with 6 bars.
TU299320 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.