RNA id: TU100143


Basic Information

Item Value
RNA id TU100143
length 275
lncRNA type inter_gene
GC content 0.40
exon number 2
gene id G74306
representative True

Chromosome Information

Item Value
chromosome id NC_035904.1
NCBI id CM008307.1
chromosome length 27092187
location 16770442 ~ 16786039 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome
species mexican tetra
(Astyanax mexicanus)

Sequence

TTCTCTGAGAAGAAATGGCTTTCTTCACAGTAAGGGTAACACACCCCGGCCTGCAGGACACTGCCCCAGTCACACGTCACACAGCTCTGAGGTGTGTTATCTGCAAACAATCGCACACCCATGTCATAAAAAATCTAACAGTATTAAAAAGATGCTTAGCTAACCTCACTCTGGTTTCTGTAAGCACTAGAGTTCGTAAAAGAGGCTAAACTAATAACAAATATCACAAACCTACTTTAGGAAACTTATTTAGTTACATCAAGTTCCAATTTAAA

Function

GO:

id name namespace
GO:0010035 response to inorganic substance biological_process
GO:0010038 response to metal ion biological_process

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU100126 lncRNA downstream 22920 16743060 ~ 16747522 (-) True G74295
TU100117 lncRNA downstream 80085 16659503 ~ 16690357 (-) True G74286
TU100116 lncRNA downstream 128786 16640842 ~ 16641656 (-) True G74285
TU100092 lncRNA downstream 261980 16508004 ~ 16508462 (-) True G74265
TU100056 lncRNA downstream 300119 16467603 ~ 16470323 (-) False LOC103041134
TU100220 lncRNA upstream 11006 16797045 ~ 16801051 (-) True G74368
TU100263 lncRNA upstream 468878 17254917 ~ 17255289 (-) True G74407
TU100308 lncRNA upstream 1019296 17805335 ~ 17813965 (-) True G74447
TU100451 lncRNA upstream 1059087 17845126 ~ 17862741 (-) True G74556
TU100453 lncRNA upstream 1071274 17857313 ~ 17866138 (-) False G74556
XM_007246487.3 mRNA downstream 31777 16618151 ~ 16738665 (-) True otud7a
XM_022672203.1 mRNA downstream 242355 16489647 ~ 16528087 (-) False LOC103042575
XM_015605134.2 mRNA downstream 247701 16489647 ~ 16522741 (-) True LOC103042575
XM_022672204.1 mRNA downstream 257836 16489647 ~ 16512606 (-) False LOC103042575
XM_007246480.3 mRNA downstream 300137 16467089 ~ 16470305 (-) True LOC103041134
XM_007246489.3 mRNA upstream 28877 16814916 ~ 16829981 (-) True bnip2
XM_007246490.3 mRNA upstream 28877 16814916 ~ 16829980 (-) False bnip2
XM_022672207.1 mRNA upstream 31603 16817642 ~ 16829981 (-) False bnip2
XM_007246492.3 mRNA upstream 172535 16958574 ~ 16965560 (-) True LOC103044821
XM_022672209.1 mRNA upstream 180743 16966782 ~ 16988490 (-) True ice2
XR_002650248.1 other downstream 992019 15761764 ~ 15778423 (-) False LOC103046265
TU99163 other downstream 2225004 14542209 ~ 14545438 (-) False LOC103025073
TU98709 other downstream 4149086 12610834 ~ 12621356 (-) True G73172
TU98667 other downstream 4205476 12564348 ~ 12564966 (-) False fbxo31
TU100463 other upstream 1090987 17877026 ~ 17883786 (-) False nrg4
TU100498 other upstream 1196708 17982747 ~ 18029747 (-) True G74591
TU100745 other upstream 2153135 18939174 ~ 18940464 (-) True G74791
TU100809 other upstream 2284899 19070938 ~ 19072888 (-) True G74838
TU101215 other upstream 3073655 19859694 ~ 19865982 (-) True G75100

Expression Profile