RNA id: TU103294



Basic Information


Item Value
RNA id TU103294
length 239
lncRNA type inter_gene
GC content 0.59
exon number 1
gene id G76579
representative True

Chromosome Information


Item Value
chromosome id NC_035904.1
NCBI id CM008307.1
chromosome length 27092187
location 25596425 ~ 25596663 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome
species mexican tetra
(Astyanax mexicanus)

Sequence


gtcgagcagccagcacactcggaggaaagcatagcagttctgatacatcagctcacagacaccctgtgctgcagacatcaccctaggagtgatgtggggagagagcaccatctacccacccggagggagcagggccaattgtgctccctctgagcaccggcagcttgatggcaaagctgcatgagcgggggttcgaacctgcgacctcccgctcatagtggcagcgctttagaccgctg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU103285 lncRNA downstream 31995 25529824 ~ 25564430 (-) True G76570
TU103118 lncRNA downstream 358412 25236454 ~ 25238013 (-) True G76453
TU103094 lncRNA downstream 383399 25207830 ~ 25213026 (-) True G76438
TU103301 lncRNA upstream 15462 25612125 ~ 25615351 (-) True G76585
TU103316 lncRNA upstream 40309 25636972 ~ 25645157 (-) False G76590
XR_002650275.1 lncRNA upstream 40409 25637072 ~ 25639133 (-) True LOC111193115
TU103310 lncRNA upstream 42639 25639302 ~ 25640726 (-) True G76590
XR_002650276.1 lncRNA upstream 43284 25639947 ~ 25641133 (-) True LOC111193116
XM_022671929.1 mRNA downstream 34478 25351525 ~ 25561947 (-) True LOC103047119
XM_007235184.3 mRNA downstream 268872 25317126 ~ 25327553 (-) True mpi
XM_022672421.1 mRNA downstream 294657 25282789 ~ 25301768 (-) False rab3il1
XM_022672425.1 mRNA upstream 18757 25615420 ~ 25631771 (-) True bbs4
XM_007235191.2 mRNA upstream 59102 25655765 ~ 25661625 (-) True adck2
XM_007231579.3 mRNA upstream 247954 25844617 ~ 25857522 (-) False mrps35
XM_015600836.2 mRNA upstream 247954 25844617 ~ 25857522 (-) True mrps35
XM_007231581.3 mRNA upstream 476434 26073097 ~ 26077993 (-) True cdkn1b
XR_002650273.1 other downstream 294657 25288850 ~ 25301768 (-) False rab3il1
XR_002650274.1 other downstream 294657 25289882 ~ 25301768 (-) False rab3il1
TU103036 other downstream 411956 25184209 ~ 25184469 (-) True G76424
XR_002650272.1 other downstream 646403 24949044 ~ 24950022 (-) True LOC107197705
TU102973 other downstream 676060 24914298 ~ 24920365 (-) True G76377
TU103672 other upstream 1266751 26863414 ~ 26868817 (-) False LOC103031319

Expression Profile


TU103294 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

TU103294 Expression in each Bioproject

Bar chart with 7 bars.
TU103294 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.