RNA id: TU52062


Basic Information

Item Value
RNA id TU52062
length 273
lncRNA type intronic
GC content 0.39
exon number 3
gene id G38611
representative True

Chromosome Information

Item Value
chromosome id NC_035900.1
NCBI id CM008303.1
chromosome length 25652880
location 23453364 ~ 23453762 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome
species mexican tetra
(Astyanax mexicanus)

Sequence

ggttagattttagggttgattaagggttaaggttagggttaggtgtagggttagattttagggttgattaagggttaaggttagggttaggtgtagggttcgattttatggttgattaagggttaaggttagggttaggtgtagggtttgattttagggttgattaagggttaaggttagggttaggtgtagggtttgattttagggttgattaagggttaaggttagggttaggtgtagggttagattttagggttgattaagggttaaggt

Function

GO:

id name namespace
GO:0050878 regulation of body fluid levels biological_process
GO:0001775 cell activation biological_process
GO:0030168 platelet activation biological_process
GO:0009611 response to wounding biological_process
GO:0007596 blood coagulation biological_process
GO:0007599 hemostasis biological_process
GO:0006508 proteolysis biological_process
GO:0050817 coagulation biological_process
GO:0042060 wound healing biological_process
GO:0004806 triglyceride lipase activity molecular_function

KEGG:

id description
ko04610 Complement and coagulation cascades

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU52027 lncRNA upstream 65943 23380968 ~ 23387421 (+) True G38585
TU52033 lncRNA upstream 98239 23349878 ~ 23355125 (+) True G38589
TU52032 lncRNA upstream 98239 23354107 ~ 23355125 (+) False G38589
TU52031 lncRNA upstream 101405 23349878 ~ 23351959 (+) False G38589
TU52025 lncRNA upstream 147059 23306058 ~ 23306305 (+) True G38583
TU52079 lncRNA downstream 41310 23495072 ~ 23513968 (+) True G38628
TU52086 lncRNA downstream 67170 23520932 ~ 23523870 (+) True G38633
TU52090 lncRNA downstream 67170 23520932 ~ 23523870 (+) False G38633
TU52091 lncRNA downstream 67170 23520932 ~ 23523870 (+) False G38633
TU52092 lncRNA downstream 67170 23520932 ~ 23522463 (+) False G38633
XM_007235379.3 mRNA upstream 56986 23387980 ~ 23396378 (+) True tfam
XM_022669358.1 mRNA upstream 452741 22998679 ~ 23000623 (+) False LOC111192392
XM_022669357.1 mRNA upstream 452741 22998867 ~ 23000623 (+) True LOC111192392
XM_007233996.3 mRNA upstream 1081877 22368776 ~ 22371487 (+) True dkk1
XM_022669352.1 mRNA upstream 1103282 22097751 ~ 22350082 (+) True prkg1
XM_007235380.3 mRNA downstream 174925 23628687 ~ 23685558 (+) True phyhipl
XM_007235381.3 mRNA downstream 205368 23659130 ~ 23685558 (+) False phyhipl
XM_022669450.1 mRNA downstream 947356 24401118 ~ 24402659 (+) True LOC111192424
XM_022669371.1 mRNA downstream 1177941 24631703 ~ 24648610 (+) True LOC111192396
XM_007235900.2 mRNA downstream 1198867 24652629 ~ 24663580 (+) True LOC103037544
XR_002649894.1 other upstream 2158074 21166568 ~ 21295290 (+) False plce1
TU51357 other upstream 2422567 21019169 ~ 21030797 (+) True G38079
TU51173 other upstream 3295025 20157880 ~ 20158339 (+) False G37943
TU51016 other upstream 3968449 19481056 ~ 19484915 (+) True G37812
TU50913 other upstream 4121703 19329368 ~ 19331661 (+) True G37749
trnar-ccu_1 other downstream 293707 23747469 ~ 23747541 (+) True trnar-ccu_1
trnar-ccu_2 other downstream 293809 23747571 ~ 23747643 (+) True trnar-ccu_2
trnar-ccu_3 other downstream 293911 23747673 ~ 23747745 (+) True trnar-ccu_3
trnar-ccu_4 other downstream 294013 23747775 ~ 23747847 (+) True trnar-ccu_4
trnar-ccu_5 other downstream 294115 23747877 ~ 23747949 (+) True trnar-ccu_5

Expression Profile