Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

ornamental fish

RNA id: TU145181

Basic Information

Item	Value
RNA id	TU145181
length	210
lncRNA type	intronic
GC content	0.48
exon number	2
gene id	G107482
representative	True

Chromosome Information

Item	Value
chromosome id	NC_035908.1
NCBI id	CM008311.1
chromosome length	31403898
location	31288735 ~ 31289411 (+)
genome version	Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome
species	mexican tetra (Astyanax mexicanus)

Sequence

tgccctgtttttctgtgctagaaatgcgcactctctccgcttttagactctttgccccgtttttgtgcgctagaaatgcgcactctctccgcttttagactctttggcccgtttttctgcactagaaatgcgcactctctctgcttttagactctttgccctgtttttctgcgctagaaatgcgcactctctccgcttttagactctttg

Function

GO: NA

KEGG: NA

JBrowse2

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

RNA id	RNA type	direction	distance	location	representative	gene id
TU145153	lncRNA	upstream	86511	31201997 ~ 31202224 (+)	True	G107463
TU145144	lncRNA	upstream	110392	31178086 ~ 31178343 (+)	True	G107454
TU145140	lncRNA	upstream	125228	31162526 ~ 31163507 (+)	True	G107450
TU145138	lncRNA	upstream	135036	31153480 ~ 31153699 (+)	True	G107448
TU145136	lncRNA	upstream	137161	31150998 ~ 31151574 (+)	True	G107446
XM_022674977.1	mRNA	upstream	577483	30672152 ~ 30711252 (+)	True	gart
XM_022674976.1	mRNA	upstream	619991	30661999 ~ 30668744 (+)	True	LOC111193577
XM_022674380.1	mRNA	upstream	741374	30540261 ~ 30547361 (+)	True	LOC111193471
XM_022674973.1	mRNA	upstream	837134	29844100 ~ 30451601 (+)	True	ncam2
XM_007237758.3	mRNA	downstream	23329	31312740 ~ 31319149 (+)	True	adamts1
XM_007237757.3	mRNA	downstream	36283	31325694 ~ 31341351 (+)	True	cyyr1
XM_022674980.1	mRNA	downstream	57890	31347301 ~ 31402273 (+)	False	app
XM_022674979.1	mRNA	downstream	57891	31347302 ~ 31402273 (+)	True	app
TU144751	other	upstream	1507808	29780326 ~ 29780927 (+)	True	G107117
TU144257	other	upstream	2568455	28716602 ~ 28720280 (+)	False	LOC103027743
TU144107	other	upstream	3221752	28066352 ~ 28066983 (+)	True	G106673
TU144092	other	upstream	3266688	28014516 ~ 28022047 (+)	False	G106661
TU143505	other	upstream	5919296	25361744 ~ 25369439 (+)	False	LOC111193563

Expression Profile