RNA id: TU34337



Basic Information


Item Value
RNA id TU34337
length 271
lncRNA type inter_gene
GC content 0.45
exon number 1
gene id G25560
representative True

Chromosome Information


Item Value
chromosome id NC_035899.1
NCBI id CM008302.1
chromosome length 74127438
location 42196383 ~ 42196653 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome
species mexican tetra
(Astyanax mexicanus)

Sequence


gaaaaaaacgcgtctggggatgaaattaaacaaaccaagccacactcaaaggaaatatgtatatataaacaaaacaaaataatggacaaaaacaacaatctaatgatagttaaatggtattaatataacagcttcaccaaaagagaatagagcttagatcgggcccaaaacgtgcacgttctgccagagcccgacccaacccgaaccatgaactgtcattatgagcccgagccgacccgatccgccccataaactgtctgttttcggtctg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
XR_002652173.1 lncRNA upstream 80862 42061924 ~ 42115521 (+) True LOC111196607
XR_002652172.1 lncRNA upstream 106396 42061924 ~ 42089987 (+) False LOC111196607
XR_002652170.1 lncRNA upstream 144898 42030080 ~ 42051485 (+) True LOC111196599
TU34247 lncRNA upstream 326376 41855959 ~ 41870007 (+) True G25493
TU34246 lncRNA upstream 326376 41860651 ~ 41870007 (+) False G25493
TU34376 lncRNA downstream 124258 42320911 ~ 42322260 (+) True G25577
TU34412 lncRNA downstream 200349 42397002 ~ 42397298 (+) True G25602
TU34442 lncRNA downstream 307128 42503781 ~ 42505297 (+) True G25624
TU34443 lncRNA downstream 322988 42519641 ~ 42519942 (+) True G25625
TU34471 lncRNA downstream 409248 42605901 ~ 42606128 (+) True G25650
XM_022685849.1 mRNA upstream 462837 41711674 ~ 41733546 (+) True kidins220
XM_022685857.1 mRNA upstream 464065 41708771 ~ 41732318 (+) False kidins220
XM_007260836.3 mRNA downstream 120870 42317523 ~ 42326404 (+) True rnaseh1
XM_022685979.1 mRNA downstream 207267 42403920 ~ 42496318 (+) True LOC103042546
XM_022685989.1 mRNA downstream 207267 42403920 ~ 42496318 (+) False LOC103042546
XM_022685982.1 mRNA downstream 207267 42403920 ~ 42496318 (+) False LOC103042546
XM_022685999.1 mRNA downstream 207267 42403920 ~ 42496318 (+) False LOC103042546
TU33591 other upstream 2370665 39819276 ~ 39825718 (+) True G24972
TU33356 other upstream 2798554 39393842 ~ 39397829 (+) False eif2b2
XR_002652014.1 other upstream 2855412 39325083 ~ 39340971 (+) True LOC111196173
TU33254 other upstream 3150602 39045170 ~ 39045781 (+) True G24719
TU33086 other upstream 3249161 38939357 ~ 38947222 (+) True G24583
TU34411 other downstream 194987 42391640 ~ 42392938 (+) True G25601
TU34410 other downstream 194992 42391645 ~ 42392938 (+) False G25601
XR_002652205.1 other downstream 301124 42497777 ~ 42516557 (+) True fgfr1op
TU34713 other downstream 1163816 43360469 ~ 43363444 (+) True rps29
TU34766 other downstream 1225118 43421771 ~ 43422046 (+) True G25879

Expression Profile


TU34337 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

TU34337 Expression in each Bioproject

Bar chart with 6 bars.
TU34337 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.