RNA id: trnat-ugu_9



Basic Information


Item Value
RNA id trnat-ugu_9
length 73
RNA type tRNA
GC content 0.56
exon number 1
gene id trnat-ugu_9
representative True

Chromosome Information


Item Value
chromosome id NC_035899.1
NCBI id CM008302.1
chromosome length 74127438
location 6923421 ~ 6923493 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome
species mexican tetra
(Astyanax mexicanus)

Sequence


GGCTCCATAGCTCAGAGGTTAGAGCACTGGTCTTGTAAACCAGGGGTCGCGAGTTCAATTCTCGCTGGGGCCT

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU22904 lncRNA downstream 4764 6918196 ~ 6918657 (-) True G16965
TU22901 lncRNA downstream 23941 6899211 ~ 6899480 (-) True G16962
TU22889 lncRNA downstream 140190 6775573 ~ 6783231 (-) True G16951
TU22875 lncRNA downstream 250665 6670069 ~ 6672756 (-) False G16939
TU23065 lncRNA upstream 72905 6996398 ~ 7001156 (-) True G17086
TU23073 lncRNA upstream 88510 7012003 ~ 7015844 (-) True G17093
TU23102 lncRNA upstream 225084 7148577 ~ 7155902 (-) True G17117
TU23106 lncRNA upstream 262700 7186193 ~ 7186801 (-) True G17121
TU23107 lncRNA upstream 263372 7186865 ~ 7187855 (-) True G17122
XM_022679618.1 mRNA downstream 26601 6675076 ~ 6896820 (-) True galnt1
XM_022679620.1 mRNA downstream 26601 6679799 ~ 6896820 (-) False galnt1
XM_015604595.2 mRNA downstream 379146 6534859 ~ 6544275 (-) True sec61b
XM_022679574.1 mRNA downstream 512000 6373166 ~ 6411421 (-) False nr4a3
XM_007229456.3 mRNA downstream 512038 6368118 ~ 6411383 (-) False nr4a3
XM_022679643.1 mRNA upstream 94464 7017957 ~ 7046918 (-) True cdh17
XM_007236504.2 mRNA upstream 133939 7057432 ~ 7065913 (-) True LOC103045397
XM_007236506.3 mRNA upstream 152310 7075803 ~ 7099361 (-) False rad54b
XM_015602248.2 mRNA upstream 152310 7075803 ~ 7098230 (-) True rad54b
XM_007236505.3 mRNA upstream 166087 7089580 ~ 7093507 (-) True fsbp
trnat-ugu_8 other downstream 106 6923243 ~ 6923315 (-) True trnat-ugu_8
trnat-ugu_7 other downstream 282 6923067 ~ 6923139 (-) True trnat-ugu_7
TU22846 other downstream 380106 6534961 ~ 6543315 (-) False sec61b
TU22791 other downstream 813221 6106906 ~ 6110200 (-) False LOC103024654
TU22789 other downstream 823106 6083120 ~ 6100315 (-) False glipr2
trnat-ugu_10 other upstream 106 6923599 ~ 6923671 (-) True trnat-ugu_10
trnat-ugu_11 other upstream 1635 6925128 ~ 6925200 (-) True trnat-ugu_11
trnat-ugu_12 other upstream 2171 6925664 ~ 6925736 (-) True trnat-ugu_12
trnat-ugu_13 other upstream 2350 6925843 ~ 6925915 (-) True trnat-ugu_13
trnat-ugu_14 other upstream 2529 6926022 ~ 6926094 (-) True trnat-ugu_14

Expression Profile


trnat-ugu_9 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

trnat-ugu_9 Expression in each Bioproject

Bar chart with 1 bar.
trnat-ugu_9 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2.
End of interactive chart.