RNA id: TU85379


Basic Information

Item Value
RNA id TU85379
length 289
lncRNA type inter_gene
GC content 0.37
exon number 1
gene id G63268
representative True

Chromosome Information

Item Value
chromosome id NC_035903.1
NCBI id CM008306.1
chromosome length 40813162
location 11701418 ~ 11701706 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome
species mexican tetra
(Astyanax mexicanus)

Sequence

attacagaaaatagataaataacattaataccaccttaataccattaacagagctctttttatatttgtttttaagctcacctcgatttactcagctttactcaacaagacttgagcatttcatcaagagaacttggacaaacagcttctgtaacccagaaaaatacaaggcttgaacacgaggagcacactaccccacagaaacaatgccatctgcccgcatctggttatgattcatccaaaatacatgtttagaaaggcaatataggcatctactactgttataggc

Function

GO:

id name namespace
GO:0030162 regulation of proteolysis biological_process
GO:0006508 proteolysis biological_process
GO:0008236 serine-type peptidase activity molecular_function
GO:0017171 serine hydrolase activity molecular_function

KEGG:

id description
ko04610 Complement and coagulation cascades
ko04972 Pancreatic secretion
ko05322 Systemic lupus erythematosus
ko05020 Prion disease

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU85357 lncRNA upstream 65872 11630642 ~ 11635546 (+) False G63260
TU85349 lncRNA upstream 65911 11630642 ~ 11635507 (+) False G63260
TU85350 lncRNA upstream 65911 11630642 ~ 11635507 (+) True G63260
TU85351 lncRNA upstream 65911 11630642 ~ 11635507 (+) False G63260
TU85352 lncRNA upstream 65911 11630642 ~ 11635507 (+) False G63260
TU85380 lncRNA downstream 16316 11718022 ~ 11718542 (+) True G63269
TU85397 lncRNA downstream 109450 11811156 ~ 11811590 (+) True G63285
TU85415 lncRNA downstream 255179 11956885 ~ 11975553 (+) True G63303
TU85449 lncRNA downstream 285292 11986998 ~ 11990396 (+) True G63328
TU85450 lncRNA downstream 305579 12007285 ~ 12007519 (+) True G63329
XM_022671327.1 mRNA upstream 1236700 10440014 ~ 10464718 (+) True brd1
XM_022671343.1 mRNA downstream 278665 11980371 ~ 11986784 (+) True LOC103028484
XM_007234936.3 mRNA downstream 288894 11990600 ~ 11997857 (+) True alg10
XM_022671347.1 mRNA downstream 659478 12361184 ~ 12373369 (+) True c7h12orf40
XM_022671348.1 mRNA downstream 659478 12361184 ~ 12373369 (+) False c7h12orf40
XM_022671350.1 mRNA downstream 659478 12361184 ~ 12373369 (+) False c7h12orf40
TU85065 other upstream 2051331 9646579 ~ 9650087 (+) True G63051
XR_002650190.1 other upstream 2260854 9433437 ~ 9440564 (+) False LOC111192948
TU84760 other upstream 3161295 8533348 ~ 8540123 (+) True LOC103041471
TU84764 other upstream 3168186 8532759 ~ 8533232 (+) False LOC103041471
TU84211 other upstream 4845656 6851230 ~ 6855762 (+) True G62455
TU85565 other downstream 766344 12468050 ~ 12468902 (+) True G63432
trnag-gcc_1 other downstream 957742 12659448 ~ 12659518 (+) True trnag-gcc_1
TU85654 other downstream 1454520 13156226 ~ 13161320 (+) False LOC111192955
TU86374 other downstream 3043029 14744735 ~ 14745082 (+) True G64015
TU86778 other downstream 4720528 16422234 ~ 16426613 (+) False arid2

Expression Profile