RNA id: TU129405



Basic Information


Item Value
RNA id TU129405
length 328
lncRNA type inter_gene
GC content 0.41
exon number 1
gene id G96058
representative True

Chromosome Information


Item Value
chromosome id NC_035907.1
NCBI id CM008310.1
chromosome length 11650534
location 527434 ~ 527761 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome
species mexican tetra
(Astyanax mexicanus)

Sequence


gactttgaggtgatggaggtaacgttagtaaagttaggattacacagggactttgaggtgatggaggtaacgttagtaaagttaggattacacagggactttgaggtgatggaggtaacgttagtaaagttaggattacacagggactttgaggtgatggaggtaacgttagtaaagttaggattacacagggactttgaggtgatggaggtaacgttagtaaagttaggattacacagggactttgaggtgatggaggtaacgttagtaaagttaggataacacagggactttgaggtgatggaggtaacgttagtaaagttaggat

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU129404 lncRNA downstream 673 526407 ~ 526761 (-) True G96057
TU129403 lncRNA downstream 1151 525949 ~ 526283 (-) True G96056
TU129386 lncRNA downstream 23906 444445 ~ 503528 (-) False G96040
TU129398 lncRNA downstream 36439 490376 ~ 490995 (-) True G96051
TU129385 lncRNA downstream 72593 444445 ~ 454841 (-) True G96040
TU129438 lncRNA upstream 50731 578492 ~ 579159 (-) True G96081
TU129562 lncRNA upstream 109621 637382 ~ 723478 (-) False G96171
TU129560 lncRNA upstream 153193 680954 ~ 684893 (-) True G96171
TU129600 lncRNA upstream 225247 753008 ~ 760508 (-) True G96204
TU129602 lncRNA upstream 228123 755884 ~ 808525 (-) False G96205
XM_007237272.3 mRNA downstream 151004 366617 ~ 376430 (-) True LOC103040905
XM_007237277.3 mRNA downstream 195287 301691 ~ 332147 (-) True LOC103042121
XM_007237278.3 mRNA downstream 284988 234312 ~ 242446 (-) True mrap2
XM_007232953.3 mRNA upstream 8685 536446 ~ 545019 (-) True dcakd
XM_007232954.3 mRNA upstream 8685 536446 ~ 544765 (-) False dcakd
XM_007232952.3 mRNA upstream 23677 551438 ~ 573290 (-) True LOC103037419
XM_022674052.1 mRNA upstream 47750 575511 ~ 576556 (-) True LOC111193396
XM_007232944.3 mRNA upstream 170962 698723 ~ 711111 (-) True dnaaf3
XR_002650509.1 other downstream 95041 431659 ~ 432393 (-) True LOC111193405
XR_002650507.1 other downstream 95768 431162 ~ 431666 (-) True LOC111193404
TU129322 other downstream 261850 252924 ~ 265584 (-) False LOC103043490
TU129943 other upstream 1284077 1811838 ~ 1814918 (-) False LOC103031019
XR_002650512.1 other upstream 1742742 2270503 ~ 2271577 (-) True LOC111193410
XR_001518422.2 other upstream 3622242 4150003 ~ 4174207 (-) False LOC107197182
trnas-aga_10 other upstream 4565125 5092886 ~ 5092967 (-) True trnas-aga_10
TU131662 other upstream 5050801 5578562 ~ 5586666 (-) True G97717

Expression Profile


TU129405 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU129405 Expression in each Bioproject

Bar chart with 6 bars.
TU129405 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.