RNA id: XR_002650507.1



Basic Information


Item Value
RNA id XR_002650507.1
length 179
RNA type ncRNA
GC content 0.58
exon number 3
gene id LOC111193404
representative True

Chromosome Information


Item Value
chromosome id NC_035907.1
NCBI id CM008310.1
chromosome length 11650534
location 431162 ~ 431666 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome
species mexican tetra
(Astyanax mexicanus)

Sequence


AGCCAGCGCCTGTGAGGAGCCCCAGATGAAGCAGAGGGCCCACATTAAGAAGTGCACAGAAGGTCAGCTGGAGGGACTCCTTCCCACCTCCCACCCAGAGTCTCCATTGCCTTCAACCACACCTGAAAGGAATGGCAGTGAGGCTCTGGTGGTGGTTGCGGAGGCAGAACCCTTGAACA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU129383 lncRNA downstream 29284 399836 ~ 401878 (-) True G96039
TU129382 lncRNA downstream 33785 395816 ~ 397377 (-) True G96038
XR_002650504.1 lncRNA downstream 165568 252340 ~ 265594 (-) False LOC103043490
XR_002650505.1 lncRNA downstream 165568 252340 ~ 265594 (-) True LOC103043490
TU129315 lncRNA downstream 204906 225396 ~ 226256 (-) True G95988
TU129385 lncRNA upstream 12779 444445 ~ 454841 (-) True G96040
TU129386 lncRNA upstream 12779 444445 ~ 503528 (-) False G96040
TU129398 lncRNA upstream 58710 490376 ~ 490995 (-) True G96051
TU129403 lncRNA upstream 94283 525949 ~ 526283 (-) True G96056
TU129404 lncRNA upstream 94741 526407 ~ 526761 (-) True G96057
XM_007237272.3 mRNA downstream 54732 366617 ~ 376430 (-) True LOC103040905
XM_007237277.3 mRNA downstream 99015 301691 ~ 332147 (-) True LOC103042121
XM_007237278.3 mRNA downstream 188716 234312 ~ 242446 (-) True mrap2
XM_007232953.3 mRNA upstream 104780 536446 ~ 545019 (-) True dcakd
XM_007232954.3 mRNA upstream 104780 536446 ~ 544765 (-) False dcakd
XM_007232952.3 mRNA upstream 119772 551438 ~ 573290 (-) True LOC103037419
XM_022674052.1 mRNA upstream 143845 575511 ~ 576556 (-) True LOC111193396
XM_007232944.3 mRNA upstream 267057 698723 ~ 711111 (-) True dnaaf3
TU129322 other downstream 165578 252924 ~ 265584 (-) False LOC103043490
TU129943 other upstream 1380172 1811838 ~ 1814918 (-) False LOC103031019
XR_002650512.1 other upstream 1838837 2270503 ~ 2271577 (-) True LOC111193410
XR_001518422.2 other upstream 3718337 4150003 ~ 4174207 (-) False LOC107197182
trnas-aga_10 other upstream 4661220 5092886 ~ 5092967 (-) True trnas-aga_10
TU131662 other upstream 5146896 5578562 ~ 5586666 (-) True G97717

Expression Profile


XR_002650507.1 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

XR_002650507.1 Expression in each Bioproject

Bar chart with 2 bars.
XR_002650507.1 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2.
End of interactive chart.