RNA id: TU221103


Basic Information

Item Value
RNA id TU221103
length 201
lncRNA type inter_gene
GC content 0.52
exon number 2
gene id G163247
representative True

Chromosome Information

Item Value
chromosome id NC_035914.1
NCBI id CM008317.1
chromosome length 41377133
location 37985058 ~ 37987068 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome
species mexican tetra
(Astyanax mexicanus)

Sequence

ACCTCGTAACCCTCTGTATTGATGGTGAAAAACATGGTGAAGGGAGCTCCCTTGGTGAACGGCTCGGCTGAAGCTGATTCCTCACTCTCCCACTTCCCGTTCCTGCAGCTGCTCAGAGTCACTTTCTGACCAATGAGTGGGTTGAAGTGGAGAGCGACGTCGTCCCCATCTGATGATCCAGTCTTGAAGTTTATGGCAAAC

Function

GO:

id name namespace
GO:0031667 response to nutrient levels biological_process
GO:0009991 response to extracellular stimulus biological_process

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU221094 lncRNA upstream 7953 37964330 ~ 37977105 (+) True G163241
TU221004 lncRNA upstream 436765 37548037 ~ 37548293 (+) True G163161
TU220944 lncRNA upstream 547009 37437568 ~ 37438049 (+) True G163110
TU220921 lncRNA upstream 610853 37374006 ~ 37374205 (+) True G163095
TU220910 lncRNA upstream 613210 37366118 ~ 37371848 (+) False G163087
TU221176 lncRNA downstream 684214 38671282 ~ 38672233 (+) True G163288
TU221184 lncRNA downstream 750651 38737719 ~ 38740775 (+) True G163296
TU221186 lncRNA downstream 755727 38742795 ~ 38744936 (+) True G163297
TU221242 lncRNA downstream 815900 38802968 ~ 38803188 (+) True G163349
TU221291 lncRNA downstream 886340 38873408 ~ 38873855 (+) True G163379
XM_007242261.3 mRNA upstream 38809 37944201 ~ 37946249 (+) True LOC103021700
XM_022679921.1 mRNA upstream 149158 37589985 ~ 37835900 (+) True LOC111194820
XM_022679915.1 mRNA upstream 477861 37460073 ~ 37507197 (+) False parp6
XM_022679415.1 mRNA downstream 957334 38944402 ~ 38945904 (+) True LOC111194723
XM_022679931.1 mRNA downstream 959108 38946176 ~ 38951124 (+) True LOC111194822
XM_022679428.1 mRNA downstream 1105411 39092479 ~ 39094807 (+) True LOC111194738
XM_007241930.3 mRNA downstream 1186256 39173324 ~ 39175138 (+) True LOC103046335
XM_022679937.1 mRNA downstream 1198154 39185222 ~ 39191405 (+) True tspan3
TU220936 other upstream 573089 37409992 ~ 37411969 (+) True G163105
TU220729 other upstream 1230371 36754185 ~ 36754687 (+) True G162964
TU219593 other upstream 5265783 32714183 ~ 32719275 (+) True G162096
TU219521 other upstream 5690029 32236316 ~ 32295029 (+) True G162032
TU219503 other upstream 5836868 32068862 ~ 32148190 (+) True G162017

Expression Profile