RNA id: TU245156


Basic Information

Item Value
RNA id TU245156
length 291
lncRNA type inter_gene
GC content 0.36
exon number 4
gene id G181005
representative True

Chromosome Information

Item Value
chromosome id NC_035916.1
NCBI id CM008319.1
chromosome length 36262418
location 34106560 ~ 34107908 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome
species mexican tetra
(Astyanax mexicanus)

Sequence

attcaactaacactgaattgaatgtccattaaatttaacttaaccctatgttgaatgtaaatgattcaaaatagaaccaaaccctacacctaaccctaaccttaacccttaatcaaccataaaatcaaaccctacaccttaccctaaccttaacccttaatcaaccctaaaatcaaaccctacacctaaccttaaccctaacccttaatcaaccataaaatcaaaccctacacctaaccctaaccttaacccttaatcaaccctaaaatcaaaccctacacctaaccctta

Function

GO:

id name namespace
GO:0050878 regulation of body fluid levels biological_process
GO:0019538 protein metabolic process biological_process
GO:0030162 regulation of proteolysis biological_process
GO:0001775 cell activation biological_process
GO:0030168 platelet activation biological_process
GO:1901564 organonitrogen compound metabolic process biological_process
GO:0051246 regulation of protein metabolic process biological_process
GO:0007596 blood coagulation biological_process
GO:0007599 hemostasis biological_process
GO:0006508 proteolysis biological_process
GO:0050817 coagulation biological_process

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05150 Staphylococcus aureus infection
ko05322 Systemic lupus erythematosus
ko05020 Prion disease

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU245092 lncRNA downstream 182832 33918934 ~ 33923728 (-) True G180958
TU245099 lncRNA downstream 183479 33885724 ~ 33923081 (-) True G180965
TU245089 lncRNA downstream 196189 33881571 ~ 33910371 (-) False G180957
TU245086 lncRNA downstream 196189 33906258 ~ 33910371 (-) True G180957
TU245084 lncRNA downstream 198075 33906258 ~ 33908485 (-) False G180957
TU245163 lncRNA upstream 35691 34143599 ~ 34143805 (-) True G181011
TU245183 lncRNA upstream 146270 34254178 ~ 34254624 (-) True G181030
TU245320 lncRNA upstream 434678 34542586 ~ 34542867 (-) True G181136
TU245458 lncRNA upstream 806317 34914225 ~ 34945421 (-) True G181252
TU245475 lncRNA upstream 848280 34956188 ~ 35016656 (-) True G181268
XM_015605340.2 mRNA downstream 105100 33987072 ~ 34001460 (-) True hunk
XM_022681462.1 mRNA downstream 170764 33921364 ~ 33935796 (-) False eva1c
XM_022681461.1 mRNA downstream 170764 33921364 ~ 33935796 (-) True eva1c
XM_015605345.2 mRNA downstream 250928 33842770 ~ 33855632 (-) False LOC103033173
XM_015605325.2 mRNA downstream 271006 33833945 ~ 33835554 (-) True LOC107197575
XM_007247298.3 mRNA upstream 400551 34508459 ~ 34510759 (-) True zar1l
XM_022681475.1 mRNA upstream 425266 34533174 ~ 34540077 (-) True rfc3
XM_022681478.1 mRNA upstream 967106 35075014 ~ 35164372 (-) True LOC103021309
XM_022681479.1 mRNA upstream 967106 35075014 ~ 35095298 (-) False LOC103021309
XM_022681480.1 mRNA upstream 1061878 35169786 ~ 35180741 (-) True LOC111195093
XR_002651488.1 other downstream 929063 33176763 ~ 33177497 (-) True LOC111195091
TU244539 other downstream 1843987 32240179 ~ 32262573 (-) False tmem135
TU244401 other downstream 2171766 31922295 ~ 31934794 (-) False LOC103030555
TU244105 other downstream 3148793 30946946 ~ 30957767 (-) False G180188
TU243597 other downstream 5255455 28850690 ~ 28851105 (-) True G179816
TU245774 other upstream 1325324 35433232 ~ 35470431 (-) True LOC103042595

Expression Profile